Release 5.0.0

• Small changes were made to support miniwdl and miniwdl is now the recommended
  tool to run this pipeline.
• Clever is now disabled by default for SV calling. It can be enabled by setting
  the Germline.svCalling.runClever input to true.
• Fixed a bug in structural variant calling which led to all INV, INS and BND
  events to be deleted if duphold filtering was enabled.
• Added a workaround for an issue with survivor's parsing of SVs detected by
  clever.
• Updated default survivor version to 1.0.7.
• Automatically create BWA index, faidx and sequence dictionary for reference
  fasta file if not provided. Automatically create dbsnpVCF index if not
  provided.
• Tumor only samples (with no control) will now be analysed in the somatic
  variant calling pipeline.
• GRIDSS results will now be included in survivor.
• Adapters should be set by the user from now on. The default adapter
  AGATCGGAAGAG (illumina universal adapter short version) actually appears
  several times in the human genome. It is recommended to use the full adapter
  sequence instead:
  • forward reads: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • reverse reads: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
• UMI deduplication is now performed using Picard
  UmiAwareMarkDuplicatesWithMateCigar. This requires FASTQ files to have the
  UMI appended to the read ID. These files can be generated by umi-tools extract.
• Added the commonVariantSites and commonVariantSitesIndex inputs to the
  somatic worklow. This allows for a separate known variant list to be
  specified for use in CNV calling, instead of the usual dbSNP.