-
Notifications
You must be signed in to change notification settings - Fork 0
/
Copy pathWu_COMBO_mapping_file.txt
103 lines (103 loc) · 256 KB
/
Wu_COMBO_mapping_file.txt
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
#SampleID BarcodeSequence LinkerPrimerSequence ASSIGNED_FROM_GEO ASPARTAME_MG_AVE TOT_CONJUGLINOLEICA_G_AVE AGE VITC_ASCORBIC_ACID_MG_AVE OXALIC_ACID_MG_AVE PUFA_EICOSAPENTAENOIC_G_AVE PHOSPHORUS_G_AVE SOLUBLE_DIETARY_FIBER_G_AVE SFA_MARGARIC_ACID_G_AVE CLA_TRANS10_CIS12_G_AVE TOTAL_DIETARY_FIBER_G_AVE BODY_SITE TARGET_GENE GLYCITEIN_MG_AVE ELEVATION RUN_DATE SAMPLE_CENTER NATURAL_FOLATE_MCG_AVE SFA_LAURIC_ACID_G_AVE TITLE NUCL_ACID_AMP CYSTINE_G_AVE NIACIN_EQ_MG_AVE BCRYPTOXANTHINPROVITA_MCG_AVE HOST_SUBJECT_ID PUFA_DOCOSAHEXAENOIC_G_AVE BCAROTENEPROVITA_MCG_AVE TOT_VIT_A_RETINOL_EQ_MCG_AVE VISIT_NUMBER DATA_NCC_DATABASE_VERSION PUFA_LINOLENIC_ACID_G_AVE LEUCINE_G_AVE LONGITUDE ASPARTIC_ACID_G_AVE DRI_LIFE_STAGE_RDA_CAT DIETARY_FOLATE_EQ_MCG_AVE TOTAL_VITAMIN_A_IU_AVE VEGETABLE_PROTEIN_G_AVE PANTOTHENIC_ACID_MG_AVE MUFA_GADOLEIC_ACID_G_AVE KEY_SEQ MANNITOL_G_AVE BODY_PRODUCT ISOMALT_G_AVE COPPER_G_AVE TRANSOCTADECENOICELAIDIC_G_AVE ERYTHRITOL_G_AVE GLYCEMIC_INDEX_GLUCOSE_REF_AVE PCR_PRIMERS VITAMIN_D_CALCIFEROL_MCG_AVE SFA_BUTYRIC_ACID_G_AVE ACAROTENEPROVITA_MCG_AVE PCR_COND NIACIN_VIT_B3_MG_AVE MANGANESE_MG_AVE INSOLUBLE_DIETARY_FIBER_G_AVE GAMMATOCOPHEROL_MG_AVE COUNTRY SFA_CAPRIC_ACID_G_AVE GLUCOSE_G_AVE SYNTH_A_R_DLATOCOPHEROL_MG_AVE DATA_SOFTWARE_VERSION_AVE VALINE_G_AVE PUFA_DOCOSAPENTAENOIC_G_AVE DAY_OF_INTAKE SFA_BEHENIC_ACID_G_AVE TOT_POLYUNSAT_FAS_G_AVE SORBITOL_G_AVE FRUCTOSE_G_AVE PHENYLALANINE_G_AVE INTERVIEWER_ID THREONINE_G_AVE VITE_TOTALPHATOCOPH_MG_AVE ENV_BIOME LUTEIN_ZEAXANTHIN_MCG_AVE SFA_CAPROIC_ACID_G_AVE NITROGEN_G_AVE MUFA_ERUCIC_ACID_G_AVE MALTITOL_G_AVE GALACTOSE_G_AVE FORMONONETIN_MG_AVE REGION AGE_UNIT LYSINE_G_AVE PERC__CAL_FROM_SFA_AVE POLYUNSATSAT_FAT_RATIO_AVE LIBRARY_CONSTRUCTION_PROTOCOL Description_duplicate GENISTEIN_MG_AVE ACESULFAME_POTASSIUM_MG_AVE HOST_COMMON_NAME TOTAL_CARBOHYDRATE_G_AVE ALCOHOL_G_AVE SUCROSE_G_AVE ENV_MATTER PUFA_PARINARIC_ACID_G_AVE TOT_ALPHATOCOPH_EQ_MG_AVE LACTITOL_G_AVE CHOLINE_MG_AVE SFA_PALMITIC_ACID_G_AVE SAMP_COLLECT_DEVICE PERC_CAL_FROM_MUFA_AVE TRANSHEXADECENOIC_A_G_AVE BIOCHANIN_A_MG_AVE ANIMAL_PROTEIN_G_AVE BETACAROTENE_MCG_AVE TRYPTOPHAN_G_AVE VITK_PHYLLOQUINONE_MCG_AVE TOTAL_FAT_G_AVE MUFA_OLEIC_ACID_G_AVE TOTAL_SUGARS_G_AVE PERC__CAL_FROM_ALCOHOL_AVE CHOLESTEROL_MG_AVE METHIONINE_G_AVE LIB_READS_SEQD CHOLESTSATURATED_FA_INDEX_AVE TOCTADECADLINOLELAIDICA_G_AVE DELTATOCOPHEROL_MG_AVE DATA_GEN_NCC_DATABASE_AVE WATER_G_AVE VIT_B12_COBALAMIN_MCG_AVE DAIDZEIN_MG_AVE COLLECTION_DATE ALTITUDE SODIUM_G_AVE IRON_G_AVE SEX TOTAL_GRAMS_AVE ADDED_SUGARS_G_AVE SFA_ARACHIDIC_ACID_G_AVE GLYCEMIC_LOAD_GLUCOSE_REF_AVE COUMESTROL_MG_AVE HISTIDINE_G_AVE PERC_CAL_FROM_CHO_AVERAGE ENERGY_KCAL_AVE ANONYMIZED_NAME LYCOPENE_MCG_AVE TAGATOSE_MG_AVE METHYLHISTIDINE_MG_AVE DATE_OF_ENTRY INOSITOL_G_AVE GLYCEMIC_LOAD_BREAD_REF_AVE POTASSIUM_MG_AVE ENERGY_KJ_AVE MALTOSE_G_AVE NUCL_ACID_EXT BODY_HABITAT STARCH_G_AVE GLUTAMIC_ACID_G_AVE PINITOL_G_AVE CAFFEINE_MG_AVE ENV_FEATURE PUFA_LINOLEIC_ACID_G_AVE PECTINS_G_AVE AGE_IN_YEARS SELENIUM__MCG__AVERAGE INTAKE_RELIABILITY THIAMIN_VITB1_MG_AVE ASH_G_AVE PERC_CAL_FROM_FAT_AVE TYROSINE_G_AVE SUCROSE_POLYESTER_G_AVE RIBOFLAVIN_VITB2_MG_AVE MUFA_MYRISTOLEIC_ACID_G_AVE EXPERIMENT_CENTER TOTAL_PROTEIN_G_AVE PHYTIC_ACID_MG_AVE SITE_ID ZINC_G_AVE TOT_TRANSFATTY_ACIDS_G_AVE MUFA_PALMITOLEIC_ACID_G_AVE TOTVITA_ACT_RETINOL_EQ_MCG_AVE COMMON_NAME DEPTH DATE_OF_BIRTH HOST_TAXID TAXON_ID AVAILABLE_CARBOHYDRATE_G_AVE ARGININE_G_AVE PROLINE_G_AVE SFA_CAPRYLIC_ACID_G_AVE PUFA_ARACHIDONIC_ACID_G_AVE CALCIUM_G_AVE ISOLEUCINE_G_AVE RUN_PREFIX LACTOSE_G_AVE GLYCEMIC_INDEX_BREAD_REF_AVE PLATFORM BETAINE_MG_AVE TOT_MONOUNSAT_FAS_G_AVE SFA_MYRISTIC_ACID_G_AVE ALANINE_G_AVE INTAKE_AMOUNT CLA_CIS9_TRANS11_G_AVE NAT_A_R_DATOCOPHEROL_MG_AVE GLYCINE_G_AVE MAGNESIUM_G_AVE BETATOCOPHEROL_MG_AVE SFA_STEARIC_ACID_G_AVE RETINOL_MCG_AVE SUCRALOSE_MG_AVE STUDY_ID EXPERIMENT_DESIGN_DESCRIPTION PERC_CAL_FROM_PROTEIN_AVE SAMP_SIZE SEQUENCING_METH OMEGA3_FATTY_ACIDS_G_AVE VIT_B6_MG_AVE TOT_SAT_FATTY_ACIDS_G_AVE PERC__CAL_FROM_PUFA_AVE SYNTHFOLATE_FOLICA_MCG_AVE VITAMIN_E_IU_AVE TARGET_SUBFRAGMENT RUN_CENTER SACCHARIN_MG_AVE XYLITOL_G_AVE SERINE_G_AVE TOTAL_FOLATE_MCG_AVE LATITUDE STUDY_CENTER Description
C.3075.01.S1.405156 CTAGAGCT CTGCTGCCTYCCGTA n 267.7586667 0.055 23.0 79.801 162.9983333 0.149 819.8103333 3.523 0.018 0.014333333 16.35066667 UBERON:feces 16S rRNA 0.418 23.27 2011 U Penn 154.078 0.047666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.745333333 27.45266667 23.09166667 3075 0.223666667 3010.007333 454.083 1 2009 0.603666667 3.956333333 -75.2 4.943333333 113 307.6776667 6020.1 31.997 3.909 0.642 TCAG 0.246333333 UBERON:feces 0 1.350666667 1.079666667 0.000333333 61.24133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.726 0.018333333 446.791 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 17.40566667 4.082666667 12.57866667 5.012333333 GAZ:United States of America 0.021666667 15.585 9.674 2009 2.609 0.043 0 0.170333333 9.587666667 0.061666667 5.841 2.386 cm 2.019666667 9.659666667 ENVO:human-associated habitat 3768.030667 0.008333333 9.308 0.783333333 0 0.036333333 0.008333333 None years 3.344666667 6.394 1.002333333 PMID:21885721 human gut metagenome 2.626666667 0 human 210.928 0 23.80633333 ENVO:feces 0 15.64466667 0 159.6373333 6.052 Fisher Brand Commode Specimen Collection System 12.00533333 0.028 0.201 23.34366667 3244.948667 0.602666667 203.5123333 42.64333333 16.50833333 47.986 0 70.656 1.124 10946 13.68133333 0.155 0.803333333 2009 3213.416 6.406333333 1.817666667 2010 0.0 4359.052667 11.72466667 female 3532.302 40.878 0.125666667 120.032 0.001333333 1.466 58.362 1433.233 3075 4944.710333 0.326333333 12.609 9/28/10 0.019 171.6036667 1893.78 5996.646333 2.507666667 PMID18248093 UBERON:feces 133.7156667 10.94633333 0.026666667 64.088 ENVO:human-associated habitat 7.641666667 1.647 23 104.011 0 1.226666667 18.16533333 26.51933333 1.728666667 0 0.995 0.007 CCME 55.351 520.9463333 ctrc 7.403 1.335 0.77 724.495 human gut metagenome 0 1987-01-01 00:00:00 9606 408170 194.577 3.496333333 2.817 0.006333333 0.108333333 474.777 2.285333333 GVJ07HB 0.209666667 87.55433333 Titanium 138.9066667 19.20433333 0.415 2.696666667 0 0.045666667 5.306333333 2.407333333 282.9523333 0.387 2.398 183.6706667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.99933333 1, tablespoon pyrosequencing 1.019333333 1.53 10.048 5.739333333 90.381 17.58233333 V2 CCME 0 0.01 2.404333333 244.4796667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3068.01.S1.405137 CGATCGTA CTGCTGCCTYCCGTA n 0 0.036333333 40.0 50.59066667 35.52066667 0.014 584.6856667 1.746 0.032 0.005666667 6.795333333 UBERON:feces 16S rRNA 0.014666667 23.27 2011 U Penn 144.1593333 0.116333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.635666667 20.099 23.29666667 3068 0.045666667 2652.857333 403.9896667 1 2009 1.683 3.248 -75.2 3.786 114 215.0363333 5056.078 8.452 2.247333333 0.233 TCAG 0.019333333 UBERON:feces 0 0.396 0.927666667 0 59.28766667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.608 0.143333333 9.387 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 12.06 0.942333333 5.040333333 10.49433333 GAZ:United States of America 0.078333333 19.01766667 0 2009 2.167333333 0.022 4 0.074333333 12.96966667 0.003 19.09266667 1.815 cm 1.651333333 3.526 ENVO:human-associated habitat 1646.814333 0.067666667 6.755333333 0.016 0 0.053333333 0 None years 3.045333333 8.579666667 1.655 PMID:21885721 human gut metagenome 0.152333333 0 human 118.411 0.028666667 25.39266667 ENVO:feces 0.000333333 4.632333333 0 164.046 5.867666667 Fisher Brand Commode Specimen Collection System 14.533 0.002 0.080666667 33.377 2669.212333 0.482333333 75.46266667 40.85366667 14.596 69.84866667 0.014 166.0766667 1.026666667 10927 17.59166667 0.185666667 1.959 2009 1205.610667 1.105666667 0.121 2010 0.0 1427.649333 4.600333333 female 1397.917667 59.988 0.100666667 69.41533333 0.012 1.164333333 44.316 997.9256667 3068 1.237 0.379666667 10.202 9/21/10 0.001666667 99.206 1024.588 4175.320333 1.234 PMID18248093 UBERON:feces 38.99433333 7.195 0.001666667 31.962 ENVO:human-associated habitat 10.975 1.15 40 46.07433333 0 0.516666667 7.309666667 40.92966667 1.417 0 0.721333333 0.027 CCME 42.002 133.658 ctrc 3.223333333 1.166 0.657666667 626.4236667 human gut metagenome 0 1970-01-01 00:00:00 9606 408170 111.6156667 2.338333333 2.509 0.027 0.128333333 322.9506667 2.055333333 GVJ07HB 5.059 84.74233333 Titanium 45.77033333 15.602 0.432333333 2.162 0 0.03 3.526 2.088 101.6726667 0.094 2.142 181.5556667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.77733333 1, tablespoon pyrosequencing 1.765 0.973666667 9.195666667 14.691 41.69033333 5.244333333 V2 CCME 0 0.006 1.795666667 185.8496667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3003.01.P1.405142 ACTGTGAC CTGCTGCCTYCCGTA n 0 0.107666667 23.0 59.55366667 65.40133333 0.005666667 750.7126667 4.059333333 0.029333333 0.013666667 11.226 UBERON:feces 16S rRNA 0.017333333 23.27 2011 U Penn 118.7423333 0.487666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.609666667 25.954 137.3446667 3003 0.031666667 284.817 302.118 1 2009 1.346 3.794333333 -75.2 4.056 113 369.6356667 1508.314667 15.62433333 3.056 0.105 TCAG 0.353666667 UBERON:feces 0 0.635 0.621333333 0.001333333 58.82933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.952333333 0.58 16.67666667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.02333333 1.422333333 6.976 10.088 GAZ:United States of America 0.425666667 11.144 0 2009 2.563666667 0.015666667 3 0.043 12.615 1.466333333 17.72933333 2.195333333 cm 1.922666667 4.851666667 ENVO:human-associated habitat 490.4053333 0.338 8.296333333 0.006333333 0 0.154666667 0 None years 2.885333333 11.691 0.747 PMID:21885721 human gut metagenome 0.174666667 0 human 159.776 0 14.068 ENVO:feces 0 5.973 0 181.3756667 9.123 Fisher Brand Commode Specimen Collection System 9.244666667 0.019333333 0 35.38266667 361.8306667 0.715666667 43.605 46.996 12.53533333 54.631 0 200.2793333 1.156333333 7952 27.24266667 0.231 2.451666667 2009 1028.677333 2.46 0.144666667 2009 0.0 2085.343333 8.422 female 1296.278333 21.84333333 0.057666667 87.449 0.027333333 1.277 50.15533333 1259.770333 3003 3403.782667 0.04 8.207333333 12/14/09 0.084 124.9743333 1305.838333 5270.880667 1.260666667 PMID18248093 UBERON:feces 87.064 10.31266667 0.000666667 0 ENVO:human-associated habitat 11.05833333 1.812333333 23 87.408 0 1.236333333 10.79966667 32.41866667 1.832 0 1.439 0.01 CCME 51.007 316.0256667 ctrc 5.809666667 1.015333333 0.668666667 332.2703333 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 148.5496667 2.288666667 3.859333333 0.287 0.127 605.3176667 2.324 GFIBTIE 10.27466667 84.07133333 Titanium 104.3553333 13.41433333 1.900666667 2.169666667 0 0.093666667 4.851666667 1.913 135.8243333 0.222 3.540333333 271.9653333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.41666667 1, tablespoon pyrosequencing 1.398333333 0.909333333 17.058 8.719333333 147.382 7.233333333 V2 CCME 0 0.003666667 2.118 266.1243333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4007.01.P1.405187 ATGCGCTA CTGCTGCCTYCCGTA n 0 0.132 19.0 100.1306667 133.965 0.021333333 1451.355667 6.463 0.066333333 0.021 21.75066667 UBERON:feces 16S rRNA 1.283666667 23.27 2011 U Penn 229.3506667 0.675333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.274666667 25.296 194.562 4007 0.031 3940.649 1475.138 1 2009 1.048333333 5.641666667 -75.2 6.219666667 113 382.839 11003.76133 21.28833333 6.151 0.103333333 TCAG 1.355 UBERON:feces 0 1.229666667 1.028 0.001666667 54.74333333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 9.051666667 0.53 685.2066667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 12.328 3.220333333 15.10433333 6.560333333 GAZ:United States of America 0.417333333 18.419 13.41 2009 3.753 0.008666667 4 0.031 8.510333333 2.049333333 27.094 3.087333333 dhc 2.396333333 10.11866667 ENVO:human-associated habitat 1130.030333 0.263666667 11.035 0.004 0 1.405 0.011 None years 4.767 8.912 0.581666667 PMID:21885721 human gut metagenome 8.129666667 10.625 human 246.0453333 0.047666667 59.19066667 ENVO:feces 0 18.25266667 0 284.675 9.068666667 Fisher Brand Commode Specimen Collection System 8.057 0.058333333 0.299333333 47.07833333 4380.543333 0.777666667 70.465 44.714 14.25233333 147.3293333 0.017 157.024 1.410666667 4747 25.16433333 0.202333333 1.732666667 2009 1904.166667 5.235333333 5.642 2010 0.0 2245.378 9.985666667 female 2233.114333 71.008 0.053333333 122.298 0.096333333 1.685333333 59.62966667 1605.553333 4007 1884.009667 4.579 7.380666667 3/8/10 0.109 174.855 3137.704 6717.634667 2.471666667 PMID18248093 UBERON:feces 62.20366667 13.22433333 0.069333333 67.68 ENVO:human-associated habitat 7.303 3.890666667 19 74.581 0 1.168333333 15.726 23.41833333 2.564 0 2.279333333 0.040666667 CCME 68.38466667 748.001 chop 9.932666667 1.383 0.796666667 1840.183333 human gut metagenome 0 1991-01-01 00:00:00 9606 408170 223.2386667 3.247666667 5.272666667 0.245666667 0.068 1536.974 3.164666667 GFIBTIE 38.74933333 78.26966667 Titanium 79.22666667 15.429 1.842 2.924666667 0 0.112 4.084 2.535 291.0423333 0.214 3.561333333 1110.093 10.625 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.063 1, tablespoon pyrosequencing 1.109666667 1.459333333 17.142 4.555 90.23666667 19.46566667 V2 CCME 0 0.039333333 3.236 319.5873333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4001.01.P1.405188 ATATGCGC CTGCTGCCTYCCGTA n 0 0.196 21.0 31.24 204.295 0 2137.835667 7.283666667 0.053333333 0.030666667 20.60233333 UBERON:feces 16S rRNA 0.343666667 23.27 2011 U Penn 246.522 0.919 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.486666667 52.99633333 2.851333333 4001 0.001666667 944.904 493.515 None 2009 1.812333333 9.417666667 -75.2 8.614333333 107 994.123 3134.455333 59.765 6.368 0.453333333 TCAG 0.348 UBERON:feces 0 2.143666667 3.969333333 0 53.78133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.320666667 1.352666667 255.918 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 29.82733333 3.931333333 13.19766667 27.55433333 GAZ:United States of America 0.844333333 30.53233333 0 2009 6.335 0 2 0.936 31.19066667 0.310333333 22.61366667 5.764666667 emd 4.011666667 13.702 ENVO:human-associated habitat 252.0636667 0.547333333 19.148 0.011333333 0 5.004 0 None years 5.983 10.78633333 0.783 PMID:21885721 human gut metagenome 3.435 0 human 459.4973333 0 70.47233333 ENVO:feces 0 16.83766667 0 269.1016667 21.924 Fisher Brand Commode Specimen Collection System 10.777 0.060333333 0 56.10366667 1074.293333 1.390333333 44.22566667 121.6833333 40.23633333 171.0546667 0 144.8766667 2.319333333 4443 48.695 0.756 4.494333333 2009 2491.318333 4.843333333 1.764 2010 0.0 7724.088333 19.42766667 male 3207.208 143.509 0.481666667 237.598 0 2.813 54.65033333 3366.92 4001 7130.140667 15.15866667 0 3/10/10 0.048666667 339.6416667 2924.417 14087.19367 9.385 PMID18248093 UBERON:feces 236.9036667 29.00466667 0.003333333 0 ENVO:human-associated habitat 29.31933333 1.676 21 179.854 0 2.8 33.15466667 31.336 4.468666667 0 3.421666667 0.044 CCME 115.715 858.045 chop 13.814 4.863 1.143 583.0393333 human gut metagenome 0 1989-01-01 00:00:00 9606 408170 438.8956667 5.303666667 11.633 0.381666667 0.020666667 2316.883 5.069 GFIBTIE 33.047 76.87933333 Titanium 418.457 42.27966667 4.240666667 4.134666667 0 0.165333333 13.702 3.639 389.9446667 0.840666667 8.296666667 403.9906667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.968 1, tablespoon pyrosequencing 1.814333333 1.270333333 41.04066667 7.93 439.8893333 20.447 V2 CCME 0 0.021 6.009 686.4106667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3067.01.S1.405183 CGATCGAT CTGCTGCCTYCCGTA n 0 0.306 32.0 113.0493333 98.24666667 0.005 1628.433333 3.540666667 0.112333333 0.053333333 13.374 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 149.2296667 2.550333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.276333333 55.459 59.05266667 3067 0.02 275.8673333 508.256 3 2009 1.918666667 7.951666667 -75.2 7.829 108 1813.704667 2149.861667 23.90233333 6.229666667 0.227666667 TCAG 0.012 UBERON:feces 0 1.071666667 2.697 0.000333333 58.88733333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 9.559666667 1.162333333 42.82866667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 34.57 5.007666667 9.765 8.308666667 GAZ:United States of America 1.242666667 56.11066667 0 2009 5.16 0.007666667 4 0.04 14.88433333 0.598 49.704 4.370333333 cm 3.886333333 6.126 ENVO:human-associated habitat 1408.803 0.933333333 16.101 0.001333333 0 0.048333333 0.001 None years 5.939 14.54 0.333333333 PMID:21885721 human gut metagenome 0.289333333 0 human 354.8473333 0.184 45.03533333 ENVO:feces 0 7.121666667 0 433.596 21.79166667 Fisher Brand Commode Specimen Collection System 10.784 0.033333333 0.000333333 75.71 326.8076667 1.253 27.863 100.207 30.76 187.8716667 0.043666667 380.3393333 2.310333333 9969 62.66166667 0.542333333 1.384333333 2009 2875.565 6.653 0.107666667 2010 0.0 2916.742333 23.08233333 male 3427.689667 106.856 0.096 201.1103333 0.000666667 2.738666667 51.27866667 2679.255 3067 171.5443333 0.01 22.995 9/21/10 0.102666667 287.4246667 2717.682667 11210.003 1.440666667 PMID18248093 UBERON:feces 142.982 19.76966667 0 52.55033333 ENVO:human-associated habitat 12.78 0.755666667 32 150.2663333 0 2.751333333 19.59033333 33.092 3.463 0 3.685 0.078333333 CCME 99.75933333 630.5493333 ctrc 20.31333333 3.530666667 1.232333333 535.49 human gut metagenome 0 1978-01-01 00:00:00 9606 408170 341.4733333 4.759333333 7.433 0.986 0.107666667 1176.459 4.594333333 GVJ07HB 35.53266667 84.15866667 Titanium 230.4253333 32.38733333 4.790333333 4.845333333 0 0.255 6.126 4.206333333 306.2363333 0.378 9.383666667 481.022 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.665 1, tablespoon pyrosequencing 1.951333333 2.662333333 43.21233333 4.588 978.8513333 9.132 V2 CCME 0 0.002 4.119 1128.080333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3043.01.S1.405217 AGTGTCAC CTGCTGCCTYCCGTA n 0 0.122 36.0 270.0163333 404.0403333 0.001 1722.832667 8.26 0.262333333 0.031333333 27.58666667 UBERON:feces 16S rRNA 0.857666667 23.27 2011 U Penn 391.7933333 0.639 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.482666667 45.667 704.4206667 3043 0.002 2280.378667 450.2426667 1 2009 2.286333333 8.233 -75.2 9.450333333 108 619.4963333 5210.986 38.98633333 5.773333333 0.941666667 TCAG 0.045 UBERON:feces 0 2.440333333 1.082 0.000333333 52.02933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.761333333 0.451333333 76.58433333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 23.46866667 5.237666667 19.171 12.099 GAZ:United States of America 0.339 27.925 0 2009 5.633333333 0.000666667 3 0.062333333 18.73766667 0.046 26.76133333 4.629 cm 4.142333333 6.101666667 ENVO:human-associated habitat 2824.504333 0.134 17.64233333 0.000333333 0 0.261 0.007333333 None years 6.944333333 10.70733333 0.610666667 PMID:21885721 human gut metagenome 5.513 0 human 269.246 12.11266667 43.02866667 ENVO:feces 0 7.458333333 0 381.9773333 16.693 Fisher Brand Commode Specimen Collection System 16.58566667 0.02 0.200333333 68.41566667 2670.881333 1.331666667 153.183 101.9106667 41.78866667 105.672 3.368666667 217.1553333 2.373666667 12973 40.85033333 0.224666667 2.023666667 2009 1311.294333 4.878333333 3.632666667 2010 0.0 2742.974333 17.69433333 male 1786.178 26.762 0.1 126.4416667 0.143666667 3.193333333 42.769 2447.255 3043 2802.398 0.018666667 28.27933333 6/3/10 0.512333333 180.7316667 3296.474 10239.314 0.22 PMID18248093 UBERON:feces 112.7846667 20.05033333 0.055333333 8.023 ENVO:human-associated habitat 16.068 4.777666667 36 137.282 0 2.072333333 17.75633333 36.57766667 3.572666667 0 2.048333333 0.086333333 CCME 107.4586667 1047.492333 ctrc 17.99833333 1.327 1.531333333 672.816 human gut metagenome 0 1974-01-01 00:00:00 9606 408170 241.6586667 6.432 6.497666667 0.177 0.128 988.1733333 4.765333333 GVJ07HB 7.475333333 74.37033333 Titanium 232.2513333 45.826 2.013666667 5.222666667 0 0.09 6.101666667 4.871666667 504.528 0.316666667 8.421 227.6696667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.25566667 1, tablespoon pyrosequencing 2.29 2.312666667 29.696 6.538 133.739 9.079666667 V2 CCME 0 0.036333333 4.574333333 525.5323333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3006.01.P1.405164 AGACTGTC CTGCTGCCTYCCGTA n 0 0.091 33.0 91.47266667 604.4733333 0.011333333 1894.425333 15.78033333 0.029666667 0.014333333 36.978 UBERON:feces 16S rRNA 0.834 23.27 2011 U Penn 350.869 1.787333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.394 60.09966667 32.19033333 3006 0.032666667 2967.179333 619.8346667 1 2009 1.644333333 8.230666667 -75.2 9.261 114 863.19 6320.015333 45.28533333 13.41 0.203 TCAG 0.093 UBERON:feces 0 2.505333333 2.938 0 49.28466667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.614333333 0.618333333 162.5233333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 39.80833333 5.563 20.97566667 12.77566667 GAZ:United States of America 0.717666667 21.73166667 18.49633333 2009 5.596666667 0.021666667 2 0.217 20.291 0.570333333 17.209 4.824333333 cm 3.896666667 20.009 ENVO:human-associated habitat 3829.865333 0.32 17.38366667 0.000666667 9.741666667 2.419333333 0.004333333 None years 6.896333333 9.914666667 0.665333333 PMID:21885721 human gut metagenome 5.116666667 0 human 317.6246667 18.53266667 52.747 ENVO:feces 0 31.68566667 0 345.363 14.14966667 Fisher Brand Commode Specimen Collection System 11.62833333 0.047 0.1 60.21366667 3064.536333 1.217666667 212.1933333 91.69966667 34.41133333 109.4193333 4.021 150.8933333 2.241666667 4092 36.82666667 0.488666667 3.163333333 2009 2993.882 6.188 3.323666667 2009 0.0 3238.743 19.77 female 3538.712333 81.60866667 0.202666667 138.5913333 0.000666667 2.809333333 48.877 2536.509667 3006 1468.09 9.550333333 14.73466667 12/22/09 0.031666667 198.0983333 3563.305333 10612.75633 3.088666667 PMID18248093 UBERON:feces 128.9593333 20.50266667 0.01 265.4593333 ENVO:human-associated habitat 18.40133333 3.355333333 33 110.128 0 2.247333333 23.60233333 30.302 3.716666667 0 3.289333333 0.005333333 CCME 105.4473333 1459.326 ctrc 14.16466667 3.546 1.004 875.2123333 human gut metagenome 0 1976-01-01 00:00:00 9606 408170 278.0313333 5.905333333 6.898333333 0.353666667 0.087333333 1541.909 4.906333333 GFIBTIE 12.224 70.44633333 Titanium 235.557 35.96133333 2.508333333 4.667333333 0 0.076666667 11.68566667 4.155666667 589.988 0.485333333 7.446333333 364.4566667 11.33333333 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.863 1, tablespoon pyrosequencing 1.709 3.312333333 28.99233333 6.552666667 301.4093333 35.89433333 V2 CCME 0 0.022666667 4.784 652.2786667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3078.01.S1.405181 CTAGTGCA CTGCTGCCTYCCGTA n 67.96133333 0.121666667 29.0 150.2436667 202.363 0.040333333 1787.213 9.847666667 0.113666667 0.017666667 29.049 UBERON:feces 16S rRNA 0.462 23.27 2011 U Penn 290.0246667 0.600333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 2.148 68.64733333 315.6846667 3078 0.078 8036.161 1581.065667 1 2009 1.975666667 9.778666667 -75.2 10.35833333 107 1167.848 17600.59933 48.03833333 8.833333333 0.200666667 TCAG 0.263666667 UBERON:feces 0 1.631 1.905 0 60.69366667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.129333333 0.805666667 1368.092667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 43.47633333 4.853666667 18.628 16.78833333 GAZ:United States of America 0.547666667 29.704 10.48266667 2009 6.269333333 0.027 2 0.090333333 19.80166667 0.029 24.71566667 5.654333333 cm 4.717333333 13.881 ENVO:human-associated habitat 1493.559333 0.416333333 20.633 0.006333333 0 0.194 0.008333333 None years 7.918 8.427333333 0.719333333 PMID:21885721 human gut metagenome 2.654333333 21.07533333 human 394.8876667 4.66 44.317 ENVO:feces 0 21.548 0 491.6963333 15.32833333 Fisher Brand Commode Specimen Collection System 9.176666667 0.020333333 0.200666667 76.42633333 8878.049667 1.51 101.384 83.629 28.111 122.6883333 1.174666667 480.1336667 2.781 5486 51.37833333 0.39 4.435333333 2009 2269.805 4.977 2.123 2010 0.0 4551.885333 27.005 male 2865.59 62.83833333 0.166666667 221.386 0.111333333 3.411 55.05533333 2832.27 3078 5580.529 0.105333333 22.78966667 9/30/10 0.310333333 316.484 3662.930333 11850.218 6.765333333 PMID18248093 UBERON:feces 209.1096667 26.08333333 0.035 239.5696667 ENVO:human-associated habitat 17.36933333 3.426 29 206.1483333 0 3.197666667 25.37466667 25.921 4.212333333 0 3.343 0.046 CCME 125.6696667 956.1816667 ctrc 13.47133333 2.348 1.043333333 2320.903333 human gut metagenome 0 1981-01-01 00:00:00 9606 408170 365.172 6.605666667 8.484 0.236666667 0.214 1270.949333 5.814666667 GVJ07HB 16.99266667 86.76366667 Titanium 268.163 29.55333333 2.228666667 5.675666667 0 0.104 9.163666667 4.827 411.8143333 0.446333333 6.244666667 841.2283333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.84366667 1, tablespoon pyrosequencing 2.120333333 3.048666667 27.101 6.103333333 516.2423333 24.11533333 V2 CCME 0 0.031 5.706 806.2666667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3086.01.S1.405130 GACACTGT CTGCTGCCTYCCGTA n 1.166666667 0.142666667 25.0 139.2423333 496.5376667 0.001666667 1330.065333 8.846 0.160666667 0.023333333 28.51333333 UBERON:feces 16S rRNA 0.04 23.27 2011 U Penn 404.6753333 0.626 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.102 33.7 1947.244333 3086 0.012666667 10490.91967 1513.173333 1 2009 1.022333333 5.188 -75.2 6.135333333 113 755.793 22453.648 35.479 6.333 0.082 TCAG 0.469 UBERON:feces 0 1.987333333 2.563 0 57.37266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.796666667 0.805666667 2138.227333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.07333333 4.964666667 19.50966667 10.065 GAZ:United States of America 0.608333333 12.98733333 0 2009 3.520333333 0.000333333 0 0.055666667 13.95933333 0.436333333 16.25766667 3.079 cm 2.434666667 8.207 ENVO:human-associated habitat 7881.441 0.430333333 11.191 0.001 0 0.165666667 0 None years 4.045333333 11.27966667 0.609666667 PMID:21885721 human gut metagenome 0.431333333 1.166666667 human 221.2556667 19.459 14.11866667 ENVO:feces 0 9.439 0 352.866 11.25666667 Fisher Brand Commode Specimen Collection System 9.692 0.066333333 0 32.743 12533.817 0.757333333 379.2346667 61.34433333 19.24233333 58.57366667 7.588666667 255.3553333 1.467333333 6211 35.13166667 0.265333333 1.941333333 2009 5000.813333 3.992333333 0.356 2010 0.0 3109.494333 24.415 female 5356.062333 13.625 0.128333333 109.5856667 0.044 1.760333333 47.97366667 1797.499 3086 2097.643 0.353666667 9.009 10/25/10 0.263333333 156.6483333 3849.403667 7520.735 3.164333333 PMID18248093 UBERON:feces 110.0596667 13.32733333 0.009333333 151.6943333 ENVO:human-associated habitat 12.79233333 3.990333333 25 86.02033333 0 1.953333333 25.95566667 29.96766667 2.332333333 0 2.242 0.092333333 CCME 68.22066667 1070.576333 ctrc 14.71733333 2.974 0.729333333 2557.658 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 192.7423333 3.950333333 4.418666667 0.274333333 0.080666667 1198.843 2.956666667 GVJ07HB 11.88033333 82.007 Titanium 445.3616667 20.30466667 2.301 3.068 0 0.12 8.207 2.775 449.4873333 0.514333333 5.195666667 468.6883333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.449 1, tablespoon pyrosequencing 1.037 2.332 22.14266667 6.577666667 206.6686667 12.21666667 V2 CCME 0 0.123 3.231 611.344 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3013.01.P1.405168 AGCTGATC CTGCTGCCTYCCGTA n 253.0803333 0.184666667 51.0 30.16333333 125.8973333 0.017333333 1298.35 3.725 0.034333333 0.040333333 14.95333333 UBERON:feces 16S rRNA 0.068666667 23.27 2011 U Penn 172.5133333 0.859666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.138666667 40.19 4.941333333 3013 0.057 2092.294667 530.4633333 1 2009 1.055333333 6.720333333 -75.2 7.056333333 114 340.849 4691.103667 25.147 3.823333333 0.296333333 TCAG 0.226666667 UBERON:feces 0 1.166333333 4.218333333 0.000666667 65.36633333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.297666667 0.991333333 22.49766667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 22.12 3.728 11.16933333 16.21333333 GAZ:United States of America 0.586 20.072 0 2009 4.514333333 0.027 0 0.087666667 18.07666667 0.042333333 21.94733333 3.819 cm 3.239333333 7.715 ENVO:human-associated habitat 938.2693333 0.361666667 14.51733333 0.094333333 0 0.396 0.000333333 None years 5.923666667 14.17033333 0.646666667 PMID:21885721 human gut metagenome 0.475 0 human 211.0936667 0 33.69433333 ENVO:feces 0 9.598666667 0 212.8713333 19.411 Fisher Brand Commode Specimen Collection System 14.705 0.064333333 0.000333333 64.31433333 2106.085333 1.084333333 71.16866667 98.18966667 32.94833333 88.56733333 0 219.898 2.011666667 9164 47.23233333 1.002333333 1.547666667 2009 2444.318333 3.002666667 0.315333333 2010 0.0 4535.746667 11.64633333 female 2817.359 62.29033333 0.162666667 127.6226667 0 2.464333333 41.99933333 2065.245667 3013 5295.299333 2.949 16.912 1/25/10 0.011 182.3716667 1960.263 8640.987667 3.211333333 PMID18248093 UBERON:feces 98.56166667 17.51733333 0.004333333 87.18266667 ENVO:human-associated habitat 16.59566667 1.627 51 111.641 0 1.410666667 20.55533333 40.77366667 3.228333333 0 1.674333333 0.020666667 CCME 89.46266667 568.8386667 ctrc 10.002 5.392666667 2.174333333 705.9706667 human gut metagenome 0 1959-02-01 00:00:00 9606 408170 196.1403333 4.483333333 6.377 0.326333333 0.188 1073.708 4.041333333 GFIBTIE 9.247333333 93.41033333 Titanium 146.5176667 35.87933333 3.316333333 3.840666667 0 0.159666667 7.715 3.760333333 285.915 0.617333333 8.979666667 354.9566667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.12066667 1, tablespoon pyrosequencing 1.157 1.453 35.87833333 8.292666667 98.89933333 11.499 V2 CCME 0 0.013 3.707666667 271.4123333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3052.01.S1.405206 ATGCTACG CTGCTGCCTYCCGTA n 0 0.159 31.0 173.168 414.8973333 0.025 1999.033333 15.518 0.074666667 0.025 50.03633333 UBERON:feces 16S rRNA 1.324666667 23.27 2011 U Penn 508.7673333 1.138 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.523333333 60.294 218.4386667 3052 0.067 14140.82533 1882.789333 1 2009 1.701333333 8.535 -75.2 11.13966667 108 739.8286667 26350.035 64.66166667 9.112333333 0.360666667 TCAG 0.400333333 UBERON:feces 0 2.490666667 3.225333333 0 57.23566667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.983666667 0.659666667 410.004 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 37.67766667 7.712333333 33.16633333 21.432 GAZ:United States of America 0.673333333 30.37533333 19.365 2009 5.682 0.022666667 2 0.392 22.549 0.207333333 24.89166667 5.290333333 cm 4.254 22.22966667 ENVO:human-associated habitat 3228.558333 0.382666667 19.23966667 0.006 0 0.276666667 0.023 None years 6.983666667 9.304 0.709 PMID:21885721 human gut metagenome 10.14566667 0 human 408.2596667 22.79766667 57.85066667 ENVO:feces 0.020666667 35.31133333 0 542.458 16.66 Fisher Brand Commode Specimen Collection System 10.37566667 0.105 0.838666667 52.367 14455.04667 1.356666667 239.248 98.00833333 33.47766667 131.831 5.544333333 400.3873333 2.286666667 18149 51.90666667 0.417666667 3.31 2009 2644.275 3.107333333 6.629666667 2010 0.0 4649.909667 24.542 male 3246.703667 97.43333333 0.295333333 208.0006667 0.003333333 2.964 50.82966667 3066.397667 3052 15432.892 0.351 12.92466667 8/19/10 0.138666667 297.298 4067.269333 12829.80767 7.529333333 PMID18248093 UBERON:feces 198.421 22.66366667 0.084 39.997 ENVO:human-associated habitat 20.38033333 5.148333333 31 165.7896667 0 2.439333333 26.85966667 28.92533333 3.735666667 0 2.613 0.026333333 CCME 117.0503333 1491.299 ctrc 16.28766667 3.899333333 1.317666667 3087.376333 human gut metagenome 0 1979-01-01 00:00:00 9606 408170 358.15 6.749 6.874333333 0.299666667 0.192666667 1171.489333 5.06 GVJ07HB 10.907 81.80433333 Titanium 314.1083333 35.424 2.422666667 5.273333333 0 0.133333333 13.51533333 4.912333333 603.5373333 0.637 7.958 678.2023333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.79833333 1, tablespoon pyrosequencing 1.837 3.183 31.57166667 6.789333333 135.7163333 39.50033333 V2 CCME 0 0.034666667 5.583666667 644.4836667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3083.01.S2.405172 CTGTAGAC CTGCTGCCTYCCGTA n 0 0.336333333 25.0 22.20866667 169.209 0.002333333 1379.007 3.386666667 0.075333333 0.061 11.33966667 UBERON:feces 16S rRNA 0.406333333 23.27 2011 U Penn 162.7103333 0.784666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.904 35.463 8.903 3083 0.008 595.4266667 466.1656667 1 2009 2.372333333 5.669666667 -75.2 5.476666667 113 495.61 2445.027 28.103 4.020666667 0.153333333 TCAG 0.273333333 UBERON:feces 0 1.133666667 7.025 0 60.32233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.924333333 0.926666667 82.12966667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 19.10966667 4.386666667 7.904333333 21.90366667 GAZ:United States of America 0.792 31.79066667 0 2009 3.784 0.003333333 0 0.107 22.96866667 0.058666667 12.678 3.256 cm 2.739333333 8.396 ENVO:human-associated habitat 151.6656667 0.604333333 12.31433333 0.018333333 0 0.174333333 0 None years 4.311666667 15.92766667 0.550666667 PMID:21885721 human gut metagenome 1.934333333 0 human 244.2643333 0.049 31.014 ENVO:feces 0 10.85666667 0 231.1433333 20.99733333 Fisher Brand Commode Specimen Collection System 15.75366667 0.108666667 0 47.625 640.943 0.981333333 62.137 113.3446667 38.31866667 98.51033333 0.016333333 189.466 1.540333333 3957 50.46433333 0.916666667 7.165666667 2009 1767.446333 4.303 1.344 2010 0.0 4254.120333 13.96366667 female 2199.212 72.99566667 0.163 140.1093333 0.284 1.949333333 42.918 2281.751667 3083 22015.009 0.143 9.637 10/14/10 0.026 200.241 2365.454667 9546.848667 3.947666667 PMID18248093 UBERON:feces 123.429 16.38133333 0.017333333 204.3833333 ENVO:human-associated habitat 20.51966667 0.985 25 122.312 0 1.702333333 18.00433333 43.791 2.627666667 0 2.285 0.113 CCME 75.79333333 470.5533333 ctrc 10.27433333 8.310333333 1.579 519.5773333 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 232.924 3.27 6.211333333 0.482333333 0.040666667 855.915 3.312333333 GVJ07HB 18.905 86.211 Titanium 201.7046667 40.25833333 3.571666667 2.981333333 0 0.282333333 8.396 2.74 232.6153333 0.498333333 11.797 412.7536667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.336 1, tablespoon pyrosequencing 2.386 1.324333333 40.585 8.479666667 195.942 12.53 V2 CCME 0 0.002666667 3.165 358.1486667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4004.01.P1.405170 ATCGATGC CTGCTGCCTYCCGTA n 10.26266667 0.056333333 5.0 60.64966667 48.83833333 0.018 760.478 2.626 0.027666667 0.005666667 8.754333333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 68.67433333 0.197333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.707 17.3 116.7183333 4004 0.032 2529.868 732.966 1 2009 1.133 2.984333333 -75.2 3.111 104 269.127 6756.742667 10.85233333 2.323 0.144 TCAG 0.296 UBERON:feces 0 0.485666667 1.065666667 0.001 57.42466667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.801666667 0.292666667 1032.404667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 9.756333333 1.634 6.131 9.125666667 GAZ:United States of America 0.193333333 17.32833333 0 2009 1.905 0.012 5 0.054 11.48166667 0.492666667 19.68866667 1.615333333 dhc 1.243666667 3.898666667 ENVO:human-associated habitat 623.248 0.120333333 5.775666667 0.001 0 0.093 0 None years 2.295333333 9.512 1.073 PMID:21885721 human gut metagenome 0.017666667 0 human 137.3083333 0 20.225 ENVO:feces 0 4.915666667 0 121.6776667 6.292333333 Fisher Brand Commode Specimen Collection System 10.553 0.002333333 0 24.996 3104.429333 0.452666667 33.58866667 37.099 11.12233333 72.18633333 0 65.91366667 0.798333333 1559 14.31433333 0.194333333 2.607 2009 1163.623 1.863 0.007333333 2010 0.0 1821.028667 6.77 male 1373.375667 30.705 0.07 74.14066667 0.022 0.907666667 52.91766667 1009.687 4004 5203.821333 0.005666667 3.499 3/18/10 0.111333333 105.9556667 1422.518 4224.530333 0.689 PMID18248093 UBERON:feces 49.32766667 7.465 0 0 ENVO:human-associated habitat 10.165 1.222666667 5 44.79433333 0 0.785 10.43966667 32.56733333 1.282333333 0 1.267666667 0.026666667 CCME 35.911 387.4903333 chop 4.226 1.297333333 0.598 991.668 human gut metagenome 0 2006-01-01 00:00:00 9606 408170 128.5536667 1.658 2.921333333 0.093 0.053666667 662.9216667 1.652333333 GFIBTIE 14.16233333 82.06766667 Titanium 39.42833333 11.984 0.956333333 1.561 0 0.050333333 3.898666667 1.446333333 141.3803333 0.196 2.452666667 474.2633333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.50466667 1, tablespoon pyrosequencing 1.195333333 0.954333333 10.91 10.10866667 117.8893333 5.799 V2 CCME 0 0.011333333 1.616666667 186.4733333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3042.01.S1.405135 AGTGCTCA CTGCTGCCTYCCGTA n 0 0.069333333 20.0 180.239 210.3316667 0.000666667 920.3283333 6.082333333 0.031333333 0.011 22.87533333 UBERON:feces 16S rRNA 0.89 23.27 2011 U Penn 286.9546667 0.731666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.565333333 19.25466667 16.43366667 3042 0.007333333 1024.153333 255.3526667 1 2009 1.117666667 2.798666667 -75.2 3.662666667 113 475.8263333 2294.757 30.419 2.849 0.121333333 TCAG 0.144666667 UBERON:feces 0 1.314666667 0.382 0 56.29033333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.043333333 0.372 9.889333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 11.59966667 3.948666667 16.46366667 10.98866667 GAZ:United States of America 0.350666667 22.674 1.896 2009 1.837666667 0 3 0.190333333 10.40866667 0.126333333 20.26433333 1.856333333 cm 1.345666667 7.059666667 ENVO:human-associated habitat 1391.944 0.262666667 6.764333333 0.003 0 0.892 0.037 None years 1.813 8.585666667 0.969333333 PMID:21885721 human gut metagenome 3.37 0 human 222.3373333 0.049 38.28466667 ENVO:feces 0 9.392333333 0 181.1143333 6.57 Fisher Brand Commode Specimen Collection System 8.734 0.022666667 0.980333333 9.937666667 1037.314667 0.459333333 99.029 41.095 13.38466667 95.257 0.024333333 114.244 0.630333333 12979 19.07733333 0.133 2.784 2009 2633.19 1.811 3.203333333 2010 0.0 1280.728333 10.94066667 female 2895.571667 68.21866667 0.136666667 112.8216667 0.003666667 0.887333333 62.886 1373.776667 3042 5480.728333 2.368 0 6/14/10 0.343333333 161.284 2040.311 5747.880667 5.523333333 PMID18248093 UBERON:feces 90.047 8.769333333 0.078 51.62666667 ENVO:human-associated habitat 9.255 2.696 20 63.62633333 0 1.069666667 12.14666667 26.19266667 1.209 0 1.177333333 0.002 CCME 40.35666667 647.8496667 ctrc 5.842 0.625 0.287 341.7956667 human gut metagenome 0 1990-01-01 00:00:00 9606 408170 199.4616667 2.237333333 2.944 0.213666667 0.027 793.9976667 1.564666667 GVJ07HB 7.618666667 80.46866667 Titanium 227.957 13.91 1.329 1.569 0 0.058333333 6.206333333 1.572666667 288.5363333 0.406 2.772 168.91 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 11.00466667 1, tablespoon pyrosequencing 1.126 0.959333333 13.23266667 6.647666667 111.077 11.17266667 V2 CCME 0 0.078666667 1.889 398.032 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3063.01.S1.405124 CATCGTAG CTGCTGCCTYCCGTA n 472.7076667 0.162 29.0 282.487 154.2003333 0.005333333 1513.926 5.441333333 0.107333333 0.026666667 23.55866667 UBERON:feces 16S rRNA 0.356666667 23.27 2011 U Penn 371.3036667 1.162666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.300666667 70.20766667 31.482 3063 0.03 1918.867 1161.58 1 2009 1.201333333 6.921 -75.2 7.594666667 107 1198.262333 6685.267333 39.98433333 31.335 0.191333333 TCAG 0.119333333 UBERON:feces 0 2.877 2.477 0 66.58066667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 15.028 0.846 183.2916667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 51.44966667 7.425333333 17.96866667 8.424333333 GAZ:United States of America 0.591 24.85866667 49.625 2009 4.629333333 0.010333333 0 0.041 9.892 0.017666667 17.17866667 4.274666667 cm 3.369333333 29.19833333 ENVO:human-associated habitat 2074.794 0.332 15.01733333 0.052333333 0 0.247666667 0.001 None years 5.600333333 12.113 0.365333333 PMID:21885721 human gut metagenome 2.064333333 0 human 307.6783333 0.151666667 39.72233333 ENVO:feces 0 57.462 0 380.4713333 14.67566667 Fisher Brand Commode Specimen Collection System 11.22 0.06 0.000666667 51.95866667 2026.257 1.125333333 237.3426667 73.16666667 24.582 101.2816667 0.046666667 346.1366667 1.943666667 16455 46.19566667 0.38 1.435 2009 4821.648667 28.04566667 1.335666667 2010 0.0 5195.251667 19.47966667 male 5289.278667 66.831 0.117 189.0696667 0.000666667 2.442666667 53.84766667 2231.368667 3063 4972.400667 16.01233333 12.84033333 9/13/10 0.068 270.2406667 2701.906333 9336.046 3.108 PMID18248093 UBERON:feces 164.6313333 18.74266667 0.010666667 34.71666667 ENVO:human-associated habitat 8.376666667 3.691666667 29 236.938 0 27.207 25.91533333 30.18133333 3.103333333 0 27.04066667 0.077 CCME 91.94533333 660.3743333 ctrc 24.82033333 2.995666667 1.470333333 1330.434667 human gut metagenome 0 1981-01-01 00:00:00 9606 408170 282.7183333 4.607666667 6.357 0.295333333 0.138666667 1097.902667 4.055666667 GVJ07HB 16.166 95.164 Titanium 170.5306667 27.442 2.753333333 3.908 0 0.137 6.867 3.461333333 411.7693333 0.284666667 7.169 992.725 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.81066667 1, tablespoon pyrosequencing 1.247333333 27.032 28.60266667 3.936 450.986 59.858 V2 CCME 0 0.028333333 4.179666667 822.4486667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4023.01.S1.405197 GACTGACT CTGCTGCCTYCCGTA n 60.73933333 0.168333333 17.0 43.858 126.2106667 0.003666667 1123.123333 5.101 0.089666667 0.025333333 16.50166667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 97.57633333 1.742 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.641666667 26.428 60.59766667 4023 0.001666667 285.0716667 542.4236667 None 2009 0.925666667 3.534 -75.2 3.724 112 400.3426667 2266.179333 19.276 3.253 0.102 TCAG 0.047 UBERON:feces 0 1.041666667 1.694333333 0.001666667 60.51366667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.943666667 0.985333333 30.033 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 16.167 3.636333333 11.354 5.084 GAZ:United States of America 0.842 15.894 0 2010 2.296333333 0 3 0.035333333 7.163 0.095 12.89733333 1.991666667 emd 1.727 3.224 ENVO:human-associated habitat 321.148 0.531666667 8.225333333 0.113666667 0 0.052666667 0.000333333 None years 3.023 17.22533333 0.258 PMID:21885721 human gut metagenome 0.055666667 0 human 187.9416667 0.033333333 48.092 ENVO:feces 0.000666667 3.879666667 0 176.3353333 12.57666667 Fisher Brand Commode Specimen Collection System 10.709 0.018666667 0 31.53633333 330.3866667 0.615666667 27.69133333 57.168 16.50233333 91.709 0.016 131.7323333 1.013 5486 34.415 0.372 1.337666667 2010 1429.761333 3.73 0.080666667 2010 0.0 2701.088667 13.725 female 1747.329 68.405 0.114 104.7636667 0.071 1.364333333 50.51266667 1437.412667 4023 1037.311667 3.037333333 9.129333333 5/5/10 0.003666667 149.7623333 1694.43 6014.136 3.408666667 PMID18248093 UBERON:feces 72.382 9.411 0 109.8236667 ENVO:human-associated habitat 6.193 1.471666667 17 75.07233333 0 1.461333333 14.91133333 34.95633333 1.586 0 1.661333333 0.047333333 CCME 50.81 622.8456667 chop 7.847333333 2.266 0.812333333 569.956 human gut metagenome 0 1993-01-01 00:00:00 9606 408170 171.44 2.220333333 3.393 0.555666667 0.01 727.789 1.974 GVJ07HB 11.364 86.50733333 Titanium 275.335 17.721 3.157333333 1.969 0 0.143 3.224 1.770333333 241.101 0.334666667 6.697333333 514.8913333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.584 1, tablespoon pyrosequencing 0.931666667 1.523333333 27.553 4.117666667 178.094 4.793666667 V2 CCME 0 0.009666667 1.983333333 275.67 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4017.01.S1.405165 GACATCTG CTGCTGCCTYCCGTA n 0 0.093333333 19.0 165.7663333 131.3586667 0.027333333 1436.633667 4.786333333 0.097333333 0.011333333 13.89833333 UBERON:feces 16S rRNA 0.729333333 23.27 2011 U Penn 271.6863333 0.608 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.247333333 63.80066667 372.1103333 4017 0.127666667 3958.124333 681.1026667 1 2009 2.864333333 7.479 -75.2 7.561333333 107 1637.026667 8098.430667 31.523 13.62033333 0.294333333 TCAG 0.100333333 UBERON:feces 0 1.875333333 0.962 0 62.303 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.049 0.654666667 107.9593333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 44.54033333 6.200333333 9.091666667 8.182333333 GAZ:United States of America 0.390666667 58.60966667 26.78 2010 4.724 0.009333333 4 0.165 26.19866667 0.548 49.99566667 4.137666667 vb 3.486 18.053 ENVO:human-associated habitat 2742.941 0.277333333 15.20033333 0.015333333 2.718 0.104 0.002 None years 6.044666667 9.445 1.108 PMID:21885721 human gut metagenome 4.634 0 human 307.249 0 36.82533333 ENVO:feces 0.006666667 33.70066667 0 264.178 12.872 Fisher Brand Commode Specimen Collection System 8.555 0.015 0.000666667 61.557 4198.159 1.155333333 181.496 77.734 19.52366667 160.948 0 235.9343333 2.055 3090 35.91166667 0.486 1.932 2010 2080.037333 10.32166667 2.716333333 2010 0.0 3511.165333 23.01566667 male 2585.256 124.7983333 0.190666667 185.0573333 0.223666667 2.415333333 52.71833333 2247.254333 4017 3955.921667 0.298333333 13.62766667 4/27/10 0.42 264.4796667 2510.294333 9402.512333 5.506666667 PMID18248093 UBERON:feces 114.86 19.43633333 0.001666667 227.5476667 ENVO:human-associated habitat 22.95333333 1.876 19 140.6196667 0 3.295666667 19.172 30.727 3.351666667 0 3.701 0.055666667 CCME 93.07533333 519.0126667 chop 15.905 1.561333333 0.804666667 1030.949 human gut metagenome 0 1991-01-01 00:00:00 9606 408170 290.6166667 4.368333333 6.826 0.21 0.076333333 1296.579667 4.219666667 GFIBTIE 9.905666667 89.04266667 Titanium 156.7326667 21.58866667 1.950333333 3.787 0 0.082333333 6.001666667 2.965666667 334.1353333 0.204333333 6.063333333 331.256 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.582 1, tablespoon pyrosequencing 3.034666667 3.35 23.87633333 10.359 802.9533333 35.69566667 V2 CCME 0 0.008333333 4.332333333 1074.640333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3062.01.S1.405208 CAGTGTCA CTGCTGCCTYCCGTA n 0 0.138666667 29.0 48.03666667 66.38 0.000333333 604.0966667 2.084333333 0.135 0.023333333 6.889666667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 81.418 0.478333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.482666667 17.32966667 46.00266667 3062 0.002333333 183.8443333 232.7216667 1 2009 1.163333333 3.056 -75.2 2.922666667 113 252.6556667 1072.822667 13.72933333 1.452333333 0.13 TCAG 0.089 UBERON:feces 0 0.546333333 2.037666667 0.001666667 63.886 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.739333333 0.597333333 11.09066667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 9.359666667 1.754 4.624333333 8.475333333 GAZ:United States of America 0.413333333 16.796 0 2009 1.991 0 0 0.058666667 11.58133333 1.127666667 18.634 1.770333333 cm 1.449 4.756666667 ENVO:human-associated habitat 291.4896667 0.188 6.357 0 0 0.156333333 0 None years 2.353 15.099 0.543666667 PMID:21885721 human gut metagenome 0.124 0 human 158.2016667 0.049666667 28.76933333 ENVO:feces 0 5.768333333 0 115.1956667 10.87866667 Fisher Brand Commode Specimen Collection System 14.269 0.061333333 0 25.389 212.391 0.478 27.68033333 58.99333333 19.28033333 67.96966667 0.034 130.9216667 0.863 17152 28.31833333 0.462 2.222333333 2009 1241.384 2.252333333 0.042666667 2010 0.0 2388.419333 7.093333333 female 1480.260667 55.43433333 0.076 97.11733333 0.047333333 1.094666667 47.46466667 1300.432667 3062 3281.221667 0.117666667 6.688333333 9/13/10 0.005 138.7906667 920.0333333 5441.010333 1.5 PMID18248093 UBERON:feces 74.19366667 8.553 0 32.8 ENVO:human-associated habitat 10.30233333 0.471 29 54.626 0 0.786333333 9.984666667 40.34166667 1.42 0 0.888666667 0.227333333 CCME 39.119 253.3753333 ctrc 7.571333333 2.606 0.889333333 250.4206667 human gut metagenome 0 1981-01-01 00:00:00 9606 408170 149.8686667 1.884 3.214666667 0.194666667 0.049666667 477.744 1.709666667 GVJ07HB 2.114 91.299 Titanium 116.054 20.705 2.197333333 1.690333333 0 0.116333333 4.756666667 1.567 112.0623333 0.354333333 5.341 215.022 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.113 1, tablespoon pyrosequencing 1.165666667 0.554333333 21.55633333 7.343333333 100.692 7.089333333 V2 CCME 0 0.010666667 1.729333333 182.11 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3081.01.S3.405193 CTGAGTCA CTGCTGCCTYCCGTA n 178.7933333 0.204333333 23.0 133.519 339.961 0.045666667 1983.463333 7.269333333 0.059666667 0.033666667 36.90566667 UBERON:feces 16S rRNA 0.160666667 23.27 2011 U Penn 401.3183333 4.387333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 2.164 84.114 171.9903333 3081 0.162333333 5737.651 1509.566 1 2009 2.530666667 11.969 -75.2 13.80966667 107 1227.273 14249.45167 41.40333333 12.21333333 0.463666667 TCAG 0.593666667 UBERON:feces 0 2.402333333 1.809 0.001333333 61.84233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 10.37833333 0.889666667 1621.349667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 56.224 5.995333333 29.097 13.902 GAZ:United States of America 1.069 49.022 22.61866667 2009 7.806 0.053333333 2 0.123333333 21.511 0.684666667 48.333 6.651666667 cm 6.013666667 17.95933333 ENVO:human-associated habitat 3023.89 0.431333333 25.462 0.318666667 1.333333333 0.666333333 0.001333333 None years 10.97566667 9.362 0.729 PMID:21885721 human gut metagenome 1.219666667 30.42366667 human 440.6356667 5.490333333 93.29333333 ENVO:feces 0.003666667 32.02366667 0 552.6563333 19.18866667 Fisher Brand Commode Specimen Collection System 7.414333333 0.071333333 0.079 115.519 6634.340667 1.673333333 159.8863333 103.1863333 27.79633333 220.372 1.778 441.234 3.596666667 2497 63.32366667 0.289 2.931 2009 3708.800667 11.11233333 0.621333333 2010 0.0 4153.549667 32.30566667 male 4414.105 163.4066667 0.134 252.695 0.041666667 4.408333333 53.622 3288.553 3081 5549.945667 1.667333333 43.392 10/11/10 0.106 361.1923333 4424.074333 13759.30533 7.917333333 PMID18248093 UBERON:feces 155.499 27.60933333 0.010666667 59.984 ENVO:human-associated habitat 18.01266667 5.222666667 23 192.7 0 3.009 25.636 24.49233333 5.032 0 3.693333333 0.057333333 CCME 157 1088.166 ctrc 24.573 2.434666667 2.203 2062.427333 human gut metagenome 0 1987-01-01 00:00:00 9606 408170 402.1863333 8.862333333 9.290666667 0.827666667 0.305666667 1175.048333 7.173 GVJ07HB 21.13933333 88.394 Titanium 270.6773333 31.365 4.511666667 8.068666667 0 0.170666667 7.781 8.001666667 515.0443333 0.512333333 8.378333333 956.7036667 15.97866667 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 20.04966667 1, tablespoon pyrosequencing 2.795666667 4.862 40.85366667 5.429333333 456.407 34.195 V2 CCME 0 0.053333333 6.480333333 857.725 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3033.01.S1.405220 AGCTGTAC CTGCTGCCTYCCGTA n 282.4373333 0.12 24.0 45.12566667 117.1423333 0.008666667 1332.462667 3.217333333 0.095666667 0.016333333 11.04666667 UBERON:feces 16S rRNA 0.061 23.27 2011 U Penn 183.296 0.356666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.795333333 29.532 5.081 3033 0.038 2960.439 467.3476667 1 2009 1.562 4.93 -75.2 5.134333333 113 464.9133333 5716.564 25.61 2.401666667 0.203666667 TCAG 0.096333333 UBERON:feces 0 0.680333333 1.029333333 0 62.48266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.468666667 0.684 60.56266667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.71033333 2.483666667 7.847666667 13.95933333 GAZ:United States of America 0.407 5.836666667 0 2009 3.116666667 0 5 0.292 20.253 0.017666667 5.428333333 2.891666667 cm 2.244 7.186 ENVO:human-associated habitat 1603.228333 0.238666667 10.46566667 0.000333333 0 0.073333333 0.000333333 None years 4.051333333 12.80266667 1.077666667 PMID:21885721 human gut metagenome 0.585666667 0 human 153.8 14.36833333 19.62033333 ENVO:feces 0.000666667 8.813 0 203.999 11.86933333 Fisher Brand Commode Specimen Collection System 12.73233333 0.018 0.000333333 38.17333333 2993.261 0.649333333 111.4186667 69.20233333 20.10333333 35.46766667 7.344 187.072 1.406666667 12458 31.631 0.371666667 2.815333333 2009 1235.159 3.174666667 0.466666667 2010 0.0 3050.167333 11.832 female 1518.31 22.989 0.194 91.984 0 1.775333333 36.761 1581.861333 3033 3279.453333 2.369666667 12.552 5/4/10 0.053666667 131.4286667 1501.157667 6618.508 2.134333333 PMID18248093 UBERON:feces 96.23433333 13.50333333 0.007333333 67.11733333 ENVO:human-associated habitat 18.56933333 1.150333333 24 101.536 0 1.219333333 14.18266667 39.93933333 2.215333333 0 1.375 0.04 CCME 63.78733333 270.1686667 ctrc 8.615666667 1.419333333 0.794333333 716.7863333 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 142.753 3.379 4.621333333 0.200666667 0.056333333 731.022 2.646 GVJ07HB 2.374666667 89.28466667 Titanium 146.0396667 22.01 2.052666667 2.808 0 0.103666667 7.186 2.573 182.755 0.506 5.138666667 217.9096667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.92366667 1, tablespoon pyrosequencing 1.609333333 1.016333333 22.05733333 11.623 165.7223333 10.72633333 V2 CCME 0 0.010333333 2.978333333 349.018 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3038.01.S2.405186 AGTCGTCA CTGCTGCCTYCCGTA n 0 0.068 50.0 177.0013333 71.90733333 0.013333333 741.729 7.535333333 0.034 0.011 13.20933333 UBERON:feces 16S rRNA 0.110666667 23.27 2011 U Penn 237.477 0.362666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.863 29.73033333 849.424 3038 0.059333333 235.3883333 319.4533333 1 2009 1.217666667 4.229333333 -75.2 5.325 114 298.4176667 1995.782333 16.12133333 5.847 0.289 TCAG 0.000666667 UBERON:feces 0 0.617 0.331 0 54.47833333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.902333333 0.374 28.10566667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 19.13166667 1.36 5.280333333 8.698 GAZ:United States of America 0.289333333 18.18633333 0 2009 2.805 0.018666667 0 0.379666667 14.75333333 0.036666667 15.752 2.457 cm 2.209666667 8.318 ENVO:human-associated habitat 1019.993 0.220333333 9.56 0.135333333 0 0.004333333 0 None years 3.851333333 11.24033333 0.835 PMID:21885721 human gut metagenome 0.314 0 human 150.0043333 0 59.61366667 ENVO:feces 0 9.275666667 0 373.8506667 10.61366667 Fisher Brand Commode Specimen Collection System 18.73566667 0.080333333 0.000333333 42.477 674.1523333 0.636 26.283 68.19433333 28.57133333 99.18466667 0 474.27 1.381666667 11485 41.846 0.09 1.328666667 2009 2918.848333 1.694666667 0.603 2010 0.0 1769.006333 5.649333333 female 3200.555667 43.32833333 0.266333333 73.84933333 0.297 1.501333333 39.593 1405.592 3038 0.042666667 0 12.49566667 5/24/10 0.778666667 105.5806667 2184.021667 5880.996667 0.570333333 PMID18248093 UBERON:feces 23.36133333 9.396666667 0 252.5866667 ENVO:human-associated habitat 13.18466667 2.059666667 50 73.18066667 0 0.794 13.73733333 42.652 1.942333333 0 1.524333333 0.011 CCME 58.59633333 253.433 ctrc 4.594333333 0.567333333 0.971666667 375.6323333 human gut metagenome 0 1960-01-01 00:00:00 9606 408170 136.7946667 3.632666667 3.055666667 0.130666667 0.198 375.2676667 2.702 GVJ07HB 5.058333333 77.887 Titanium 48.96566667 30.203 1.274333333 2.781666667 0 0.056666667 8.318 2.438 205.967 0.187333333 3.630666667 263.2736667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.64233333 1, tablespoon pyrosequencing 1.308666667 1.246333333 17.953 9.323 35.878 12.38933333 V2 CCME 0 0.002666667 2.636666667 273.355 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3009.01.P1.405180 AGCTACGT CTGCTGCCTYCCGTA n 94.62833333 0.058 31.0 62.85233333 164.9116667 0.005 811.96 5.538333333 0.031 0.008333333 17.78066667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 220.8973333 0.264 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.778 25.189 22.68533333 3009 0.024666667 12381.603 1500.843667 1 2009 1.833666667 3.757 -75.2 4.226333333 114 415.4246667 25232.34733 22.031 3.681 0.165333333 TCAG 0.531666667 UBERON:feces 0 0.926666667 0.371666667 0 59.946 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.84 0.455666667 4343.726 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.89533333 2.637666667 12.07033333 14.26466667 GAZ:United States of America 0.358666667 10.03766667 0 2009 2.525 0.005666667 3 0.081333333 14.66933333 0.028333333 7.528333333 2.363666667 cm 2.011 7.845666667 ENVO:human-associated habitat 1951.682 0.157333333 8.045333333 0.001333333 0 0.062 0 None years 2.954333333 8.595666667 1.039666667 PMID:21885721 human gut metagenome 0.053666667 21.07533333 human 168.0823333 21.18066667 21.23566667 ENVO:feces 0 9.472666667 0 234.516 7.831 Fisher Brand Commode Specimen Collection System 9.679333333 0.024333333 0.000666667 27.19933333 14564.80967 0.617333333 168.7486667 48.274 14.805 42.471 10.315 242.3833333 1.055333333 13980 26.28866667 0.213 3.505666667 2009 2064.139333 1.154666667 0.134666667 2010 0.0 2268.946333 9.207 female 2347.398 24.22033333 0.124666667 90.26666667 0 1.294666667 46.21566667 1427.731667 3009 9650.116 0.719333333 4.289666667 1/18/10 0.120333333 129.008 2232.780667 5973.629 1.484666667 PMID18248093 UBERON:feces 94.598 11.589 0 124.336 ENVO:human-associated habitat 12.69066667 2.308666667 31 78.15 0 1.080333333 13.638 29.89866667 1.756333333 0 1.352666667 0.024666667 CCME 49.23166667 451.715 ctrc 5.257 0.666333333 0.560333333 2714.578 human gut metagenome 0 1979-01-01 00:00:00 9606 408170 150.3016667 2.418 3.672 0.13 0.088 608.164 2.232 GFIBTIE 2.122333333 85.67733333 Titanium 108.069 15.63966667 1.222333333 2.055666667 0 0.05 7.845666667 1.674 211.7793333 0.414333333 3.185666667 287.1093333 1060.228 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.671 1, tablespoon pyrosequencing 1.869333333 1.413666667 14.02933333 9.181666667 114.361 11.69233333 V2 CCME 0 0.035 2.337 335.2576667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3032.01.S2.405127 ACTGCTGA CTGCTGCCTYCCGTA n 0 0.141666667 24.0 26.09933333 177.3516667 0.005 939.03 4.039666667 0.09 0.017 11.33466667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 155.1866667 0.528 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.798666667 32.579 11.23033333 3032 0.016333333 3655.544667 569.071 1 2009 1.169666667 5.092666667 -75.2 5.129 107 330.1176667 7543.527667 20.11733333 3.194 0.078 TCAG 0.337666667 UBERON:feces 0 0.721666667 0.736333333 0 64.17833333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.727 0.904666667 808.084 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.258 2.141666667 6.798666667 8.361666667 GAZ:United States of America 0.563 5.453 0 2009 3.412333333 0.01 5 0.048666667 9.521 0.031666667 5.006666667 2.944333333 cm 2.514666667 4.613 ENVO:human-associated habitat 1625.675 0.276666667 10.80666667 0.07 0 0.323 0.002333333 None years 4.061 13.638 0.681666667 PMID:21885721 human gut metagenome 0.110666667 0 human 114.4013333 12.46566667 2.896666667 ENVO:feces 0 5.569666667 0 169.3063333 10.56433333 Fisher Brand Commode Specimen Collection System 9.207333333 0.071333333 0.085666667 46.66833333 4065.202 0.859 107.2076667 48.57866667 12.50966667 17.21266667 10.262 165.8 1.512333333 10534 29.46733333 0.247333333 2.103666667 2009 2040.109 3.183 0.19 2010 0.0 2826.593667 11.16766667 male 2254.336667 4.656333333 0.066 67.35433333 0.013666667 1.808666667 34.99166667 1246.281667 3032 13463.79933 0 11.82733333 5/4/10 0.086333333 96.24166667 1592.877333 5214.442667 2.442666667 PMID18248093 UBERON:feces 77.49266667 14.07266667 0.004333333 127.28 ENVO:human-associated habitat 8.152666667 1.043 24 82.39266667 0 1.166666667 14.92 32.07666667 2.445666667 0 1.331666667 0.084 CCME 66.78466667 250.591 ctrc 8.832666667 1.115 0.912 907.8376667 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 103.067 2.915333333 5.185333333 0.253333333 0.077333333 912.0516667 3.035666667 GVJ07HB 1.091 91.71033333 Titanium 147.0233333 13.83133333 2.809666667 2.814 0 0.124666667 4.613 2.474333333 188.652 0.249666667 4.536 230.3043333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 22.59733333 1, tablespoon pyrosequencing 1.200666667 1.051 20.96733333 6.517333333 102.8433333 6.867333333 V2 CCME 0 0.022666667 2.707333333 258.0303333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4019.01.P1.405146 GCGCTATA CTGCTGCCTYCCGTA n 0 0.167 13.0 80.675 148.0433333 0.002666667 812.532 5.202333333 0.097666667 0.026 12.17133333 UBERON:feces 16S rRNA 0.019333333 23.27 2011 U Penn 141.2203333 0.723 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.632 24.898 126.59 4019 0.012666667 444.4226667 376.725 None 2009 1.001666667 3.58 -75.2 4.259333333 105 373.182 1991.828333 25.09933333 3.147333333 0.154333333 TCAG 0.045 UBERON:feces 0 0.979666667 0.997666667 0 66.21133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.271333333 1.082 44.571 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.51066667 2.063333333 6.908666667 6.045 GAZ:United States of America 0.748666667 27.59866667 0 2010 2.417666667 0 2 0.035 10.852 0.166333333 21.39966667 2.249333333 emd 1.646333333 6.432666667 ENVO:human-associated habitat 624.7883333 0.490333333 7.631333333 0.004666667 0 0.272 0 None years 2.610333333 12.55766667 0.431333333 PMID:21885721 human gut metagenome 0.260666667 0 human 256.681 0 44.87666667 ENVO:feces 0 7.306333333 0 194.5016667 12.34366667 Fisher Brand Commode Specimen Collection System 10.83133333 0.019666667 0.002333333 21.276 530.003 0.623333333 38.272 61.99933333 19.82033333 102.8343333 0 235.3813333 0.930333333 3129 36.74266667 0.264666667 1.333 2010 1387.118667 1.469 0.395 2010 0.0 2692.604333 9.519333333 male 1747.433333 94.476 0.087666667 162.2473333 0.044 1.211 58.12666667 1742.777667 4019 3402.72 0.507333333 0 4/7/10 0.202 231.882 1695.230667 7291.783 4.588 PMID18248093 UBERON:feces 124.5203333 10.70466667 0 0.607333333 ENVO:human-associated habitat 9.746333333 2.101666667 13 56.31266667 0 1.290333333 13.02366667 31.47933333 1.85 0 1.211333333 0.02 CCME 46.375 333.3736667 chop 5.741 1.294333333 0.876 420.8916667 human gut metagenome 0 1997-01-01 00:00:00 9606 408170 244.51 2.301 3.877 0.365666667 0.052666667 687.253 2.042333333 GFIBTIE 4.099 94.62766667 Titanium 114.1013333 21.28066667 3.048 1.685666667 0 0.141333333 6.432666667 1.495666667 184.3056667 0.641 5.297666667 332.558 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 10.43 1, tablespoon pyrosequencing 1.016333333 0.974666667 24.72633333 5.501666667 136.4163333 9.599333333 V2 CCME 0 0.020333333 2.268666667 277.6366667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3076.01.S1.405174 CTAGCATG CTGCTGCCTYCCGTA n 62.98866667 0.204 26.0 270.6386667 213.2873333 0.001666667 1533.080333 6.163 0.086333333 0.031333333 23.27533333 UBERON:feces 16S rRNA 0.655 23.27 2011 U Penn 362.957 1.325 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.017 36.103 16.828 3076 0.012666667 3553.876333 682.5316667 1 2009 2.213666667 6.038 -75.2 6.426 113 665.0566667 7351.348 44.38633333 5.344666667 0.277666667 TCAG 0.285666667 UBERON:feces 0 1.568666667 1.178666667 0 51.651 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.286666667 1.278 188.0576667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.48666667 4.025333333 16.54133333 19.16433333 GAZ:United States of America 1.734666667 37.794 0.148 2009 4.167333333 0 0 0.387 26.46366667 0.043666667 27.50566667 3.812666667 cm 2.866333333 13.41566667 ENVO:human-associated habitat 4972.795333 0.838666667 13.115 0.002333333 0 0.312333333 0 None years 4.087666667 12.70233333 0.745 PMID:21885721 human gut metagenome 3.833333333 0 human 262.3023333 23.39533333 36.73833333 ENVO:feces 0 15.74833333 0 367.6513333 18.02066667 Fisher Brand Commode Specimen Collection System 13.32066667 0.090666667 0.000333333 35.33333333 3656.319667 1.057 329.538 106.5766667 35.996 121.7693333 5.723 300.2536667 1.521 7099 50.879 0.412333333 4.27 2009 2150.881 5.265 2.399333333 2010 0.0 4563.976667 23.465 female 2555.997333 55.42433333 0.318 123.957 0 1.915666667 43.89933333 2424.850333 3076 20341.68267 1.068333333 0 9/28/10 0.519 177.1716667 3889.797667 10145.575 1.231666667 PMID18248093 UBERON:feces 96.766 17.28233333 0.025333333 25.136 ENVO:human-associated habitat 24.17066667 4.288 26 122.2436667 0 4.388666667 26.40033333 37.93733333 2.817 0 2.892666667 0.038333333 CCME 79.66633333 771.9136667 ctrc 10.035 1.798333333 0.925 987.225 human gut metagenome 0 1984-01-01 00:00:00 9606 408170 238.6253333 3.957666667 6.254333333 0.688666667 0.054 1485.187333 3.509 GVJ07HB 18.18766667 73.825 Titanium 162.5796667 37.48966667 4.144 3.037333333 0 0.172333333 13.349 2.512333333 394.104 0.731 6.094333333 377.8383333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.49166667 1, tablespoon pyrosequencing 2.228333333 2.025666667 35.51133333 9.327666667 177.5956667 20.05833333 V2 CCME 0 0.031666667 4.068333333 540.5523333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3018.01.P1.405222 AGTCTCAG CTGCTGCCTYCCGTA n 0 0.1 45.0 17.65433333 73.65066667 0.003333333 855.4416667 2.813666667 0.087666667 0.026 11.44233333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 121.063 0.277333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.667 25.40033333 4.178666667 3018 0.017666667 348.8656667 223.051 1 2009 1.237 3.730666667 -75.2 3.707333333 114 262.0823333 1261.062 22.02933333 2.511 0.209 TCAG 0.151 UBERON:feces 0 0.839 1.147333333 0 62.504 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.714 0.548 40.78333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.674 3.814666667 8.462666667 8.196666667 GAZ:United States of America 0.322 53.16866667 0 2009 2.472333333 0.003333333 0 0.059 11.25666667 0.552 61.812 2.216666667 cm 1.854 3.53 ENVO:human-associated habitat 334.288 0.196666667 9.316333333 0.001666667 0 0.145666667 0.000666667 None years 2.979 10.41266667 0.608 PMID:21885721 human gut metagenome 0.047 0 human 236.0603333 0 28.492 ENVO:feces 0 4.461333333 0 197.542 10.50866667 Fisher Brand Commode Specimen Collection System 10.14133333 0.027 0 34.25233333 371.3466667 0.643666667 35.28433333 53.356 16.881 148.8833333 0 242.531 1.107333333 11675 31.38266667 0.272333333 2.162333333 2009 2146.324 2.037333333 0.138 2010 0.0 2840.878333 8.875 female 2477.081 117.4453333 0.106333333 140.7176667 0.000333333 1.346666667 56.69133333 1634.131333 3018 6485.035333 0.737666667 7.989666667 2/9/10 0.098666667 201.0733333 1232.573 6837.206 4.405 PMID18248093 UBERON:feces 72.838 10.49666667 0 86.19566667 ENVO:human-associated habitat 9.784666667 0.802 45 95.01433333 0 1.100333333 14.368 29.03033333 1.785333333 0 1.097 0.021666667 CCME 56.844 436.864 ctrc 6.476333333 1.649666667 0.967666667 253.9963333 human gut metagenome 0 1965-06-01 00:00:00 9606 408170 224.618 2.408666667 3.807 0.167333333 0.117333333 588.8323333 2.184666667 GFIBTIE 0.86 89.31266667 Titanium 237.1726667 18.52933333 1.728 2.122333333 0 0.084333333 3.53 1.972333333 168.8593333 0.226666667 4.907666667 192.1056667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.349 1, tablespoon pyrosequencing 1.261 0.814 19.06566667 6.028333333 82.83333333 5.256666667 V2 CCME 0 0.012 2.199666667 203.8963333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3011.01.P1.405224 AGCTCTAG CTGCTGCCTYCCGTA n 0 0.191666667 36.0 28.99566667 113.6716667 0.003666667 915.252 3.946 0.050666667 0.044666667 12.522 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 140.5433333 0.328666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.903666667 28.152 153.5493333 3011 0.019 2845.171333 503.7173333 1 2009 2.682 4.925333333 -75.2 5.16 114 328.0873333 6273.836 22.96533333 3.161 0.296 TCAG 0.166333333 UBERON:feces 0 0.858 1.288333333 0 66.38733333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.509333333 0.588666667 774.1206667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 16.94833333 4.453 8.511 16.731 GAZ:United States of America 0.368333333 62.13766667 0 2009 3.142666667 0.004 1 0.167666667 20.95833333 0.103666667 53.731 2.838333333 cm 2.344 6.326666667 ENVO:human-associated habitat 796.209 0.21 10.955 0.039666667 0 0.102 0.001333333 None years 4.342666667 10.83966667 0.993333333 PMID:21885721 human gut metagenome 0.031333333 0 human 284.9056667 0 45.767 ENVO:feces 0 8.206 0 253.7783333 14.251 Fisher Brand Commode Specimen Collection System 11.76166667 0.056 0.000333333 43.60066667 3309.023333 0.672 91.419 79.496 25.29233333 169.138 0 255.4636667 1.449666667 14636 38.15366667 0.443333333 4.589 2009 2149.781 2.471333333 0.075 2010 0.0 3383.850667 11.29266667 female 2593.746667 149.6376667 0.185666667 180.5363333 0.001 1.850333333 53.19233333 2083.199 3011 7711.294333 0.412 14.451 1/21/10 0.011 257.9706667 1540.777 8716.104333 3.669333333 PMID18248093 UBERON:feces 107.4 13.21233333 0.000333333 126.601 ENVO:human-associated habitat 18.11033333 1.678333333 36 110.1196667 0 1.231666667 16.19533333 33.751 2.251 0 1.294333333 0.064666667 CCME 67.02466667 348.4553333 ctrc 8.782333333 1.953 1.365333333 779.4693333 human gut metagenome 0 1974-01-01 00:00:00 9606 408170 272.3836667 3.446 4.482 0.182666667 0.096 691.111 2.802 GFIBTIE 3.730666667 94.863 Titanium 183.8273333 27.50466667 2.108 2.905333333 0 0.156 6.326666667 2.680666667 176.812 0.400666667 6.270666667 227.9653333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.22 1, tablespoon pyrosequencing 2.709 1.030666667 25.129 8.595666667 110.106 9.439 V2 CCME 0 0.006333333 2.860333333 250.6486667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3044.01.S1.405221 ATATCGCG CTGCTGCCTYCCGTA n 16.99033333 0.140666667 46.0 145.4946667 150.528 0.159666667 1421.302 8.623666667 0.087 0.030666667 30.95466667 UBERON:feces 16S rRNA 0.568666667 23.27 2011 U Penn 317.7866667 0.999 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.235666667 42.11333333 134.385 3044 0.556333333 1223.733667 563.2793333 1 2009 1.735333333 6.828666667 -75.2 7.643 114 481.7873333 3730.962667 30.22833333 5.974666667 0.304666667 TCAG 0.717666667 UBERON:feces 0 1.384333333 1.694333333 0 53.82233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 8.166333333 0.724333333 85.61533333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 26.51433333 4.300666667 21.837 10.88466667 GAZ:United States of America 0.578 18.239 1.211333333 2009 4.454666667 0.144 4 0.126333333 15.285 0.356333333 21.702 3.756 cm 3.173666667 9.969 ENVO:human-associated habitat 1794.415333 0.383 14.435 0.158333333 0 0.4 0 None years 5.910666667 11.364 0.626 PMID:21885721 human gut metagenome 2.357333333 5.268666667 human 274.915 15.438 46.49866667 ENVO:feces 0.040333333 11.965 0 387.457 14.00533333 Fisher Brand Commode Specimen Collection System 10.279 0.051666667 0 59.202 1333.734 0.935666667 85.50933333 73.82766667 23.414 105.358 4.609666667 269.1813333 1.969666667 4300 41.11666667 0.302666667 3.759 2009 3030.047333 5.847 2.123666667 2010 0.0 2818.354667 14.17033333 female 3467.446333 61.29966667 0.122666667 130.56 0 2.383 49.07633333 2180.394 3044 3795.485 0.912333333 19.90066667 6/8/10 0.170333333 186.5966667 3084.373333 9122.768667 3.101 PMID18248093 UBERON:feces 115.0243333 16.57766667 0.012666667 24.00033333 ENVO:human-associated habitat 12.35233333 4.22 46 128.0806667 0 1.759 19.17333333 29.958 2.943333333 0 2.265333333 0.052666667 CCME 89.22466667 666.9293333 ctrc 11.38 2.074666667 1.415 674.4236667 human gut metagenome 0 1964-01-01 00:00:00 9606 408170 243.9293333 4.516666667 5.783666667 0.284 0.213 936.9476667 3.893 GVJ07HB 15.41666667 76.92233333 Titanium 144.412 25.53166667 2.74 4.152666667 0 0.118333333 9.424 3.697333333 356.4343333 0.509666667 6.61 452.135 4 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.48666667 1, tablespoon pyrosequencing 2.635333333 2.416666667 27.384 6.048333333 96.35466667 15.24166667 V2 CCME 0 0.044333333 3.939333333 414.141 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3084.01.S1.405134 CTGTCAGA CTGCTGCCTYCCGTA n 0 0.095333333 22.0 39.499 86.29433333 0.003 1171.057333 3.177 0.078333333 0.013333333 11.03633333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 138.4563333 0.435666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.216333333 31.83433333 48.65566667 3084 0.022 1858.098333 658.3293333 1 2009 1.051333333 5.468666667 -75.2 5.182333333 113 654.115 4818.549667 21.115 3.489333333 0.068333333 TCAG 0.299666667 UBERON:feces 0 0.903333333 2.537 0.001666667 61.11 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.225 0.707666667 14.271 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 17.70433333 1.939 7.687666667 11.26 GAZ:United States of America 0.479 18.221 0 2009 3.497333333 0.006666667 0 0.034666667 12.73066667 1.219666667 16.35033333 3.095 cm 2.419333333 3.836 ENVO:human-associated habitat 1304.724 0.309666667 10.99766667 0.005666667 0 0.151666667 0 None years 4.276 11.658 0.626666667 PMID:21885721 human gut metagenome 0.012 0 human 248.4326667 0 55.745 ENVO:feces 0 5.091666667 0 257.7283333 11.89266667 Fisher Brand Commode Specimen Collection System 9.475 0.022 0 46.44833333 1889.585667 0.847666667 66.73433333 59.775 18.376 113.3713333 0 272.5506667 1.503 8745 37.09633333 0.74 3.873 2009 1964.062667 4.285333333 0.015666667 2010 0.0 2293.523667 13.76966667 female 2328.727 73.999 0.105666667 144.3783333 0.002 1.769 54.355 1767.259 3084 4596.212333 2.380333333 8.410666667 10/25/10 0.019 206.3396667 1785.829667 7394.211667 3.864 PMID18248093 UBERON:feces 118.524 14.72333333 0.002 6.746666667 ENVO:human-associated habitat 11.52433333 1.022666667 22 115.195 0 1.664 14.90533333 29.79433333 2.502333333 0 2.120333333 0.022333333 CCME 67.563 492.2006667 ctrc 9.693 3.330333333 0.652333333 815.795 human gut metagenome 0 1988-01-01 00:00:00 9606 408170 236.396 3.184333333 5.5 0.228666667 0.1 1069.573 3.068333333 GVJ07HB 19.03966667 87.334 Titanium 129.9703333 19.224 1.929 2.967666667 0 0.082 3.836 2.492 211.7856667 0.226666667 6.839666667 500.864 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.875 1, tablespoon pyrosequencing 1.083 1.237 23.23633333 6.443333333 303.1406667 5.703666667 V2 CCME 0 0.013666667 3.230666667 441.5966667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3010.01.P1.405139 AGCTCATG CTGCTGCCTYCCGTA n 0 0.081666667 43.0 166.1166667 199.9626667 0.020666667 1499.838667 8.115 0.113333333 0.013333333 25.604 UBERON:feces 16S rRNA 1.33 23.27 2011 U Penn 342.838 0.218666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.267333333 48.19466667 616.024 3010 0.039666667 9287.253333 1650.590667 1 2009 1.370666667 5.792 -75.2 6.664666667 108 835.986 21571.90633 41.96133333 5.652666667 0.230333333 TCAG 0.851 UBERON:feces 0 1.981 2.336333333 0 61.35533333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 7.193333333 0.337 3961.859667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 31.661 7.312666667 17.127 14.81366667 GAZ:United States of America 0.223666667 43.508 0.759 2009 3.747333333 0.025 2 0.089 15.55733333 0.374666667 45.62433333 3.371333333 cm 2.903 8.824333333 ENVO:human-associated habitat 1963.090667 0.135333333 13.69166667 0.087666667 0 0.843 0.000666667 None years 4.563 6.270333333 1.077333333 PMID:21885721 human gut metagenome 8.414 0 human 357.5883333 0 58.62 ENVO:feces 0.002666667 11.00766667 0 311.827 9.704666667 Fisher Brand Commode Specimen Collection System 8.239333333 0.005666667 0 42.16033333 11576.19533 0.992 101.2656667 57.38833333 19.66733333 161.8523333 0 117.2406667 1.598333333 12483 22.20433333 0.397 4.852666667 2009 2264.871667 18.59266667 6.463 2010 0.0 3804.102 20.631 male 2747.496667 96.03 0.090666667 203.7043333 0.281666667 1.97 62.19633333 2249.328667 3010 2348.902333 0.018666667 11.991 1/21/10 0.576 291.118 3535.811333 9411.191 2.478 PMID18248093 UBERON:feces 155.046 17.375 0.112 113.765 ENVO:human-associated habitat 13.49933333 3.956666667 43 123.325 0 2.020666667 21.93033333 22.553 2.65 0 2.768333333 0.067333333 CCME 84.20833333 960.333 ctcr 12.292 2.869333333 0.79 2615.273667 human gut metagenome 0 1967-01-01 00:00:00 9606 408170 331.984 4.110333333 5.478666667 0.099333333 0.084333333 1588.547 3.441333333 GFIBTIE 10.77866667 87.685 Titanium 242.2776667 21.037 1.165 3.451 0 0.069333333 8.483 3.056333333 354.522 0.592333333 3.782 685.9073333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.268 1, tablespoon pyrosequencing 1.459 2.787 16.18033333 6.239 289.9536667 13.394 V2 CCME 0 0.018333333 3.292666667 632.792 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4020.01.P1.405158 GCATGCTA CTGCTGCCTYCCGTA n 0 0.066 2.0 48.964 84.17233333 0.002666667 728.1016667 5.126666667 0.052666667 0.011666667 14.55133333 UBERON:feces 16S rRNA 2.91 23.27 2011 U Penn 132.3746667 0.208333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.641333333 22.55066667 212.272 4020 0.012 2869.116667 617.7156667 None 2009 0.959666667 3.762666667 -75.2 4.937 103 195.6793333 6634.971 25.37466667 2.197333333 0.055333333 TCAG 0.099333333 UBERON:feces 0 0.963333333 0.955666667 0.002333333 68.217 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.459333333 0.229 636.5123333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 13.10233333 1.922 9.422333333 12.92966667 GAZ:United States of America 0.177666667 21.68766667 11.81066667 2010 2.489666667 0.006666667 3 0.023333333 8.752 0.133 19.821 2.22 emd 1.983666667 7.913666667 ENVO:human-associated habitat 752.1113333 0.134333333 8.116 0.002 0 0.104 0.002666667 None years 3.438 8.598 0.822 PMID:21885721 human gut metagenome 23.90566667 0 human 164.3126667 0.065 25.26166667 ENVO:feces 0.000333333 15.93366667 0 162.1383333 5.893666667 Fisher Brand Commode Specimen Collection System 8.913333333 0.048666667 0.297333333 23.874 3293.509 0.567 48.599 33.50033333 10.27833333 84.14233333 0.04 101.2593333 1 3867 15.98666667 0.174333333 7.822333333 2010 875.7606667 6.123 23.44366667 2010 0.0 1958.083333 9.93 male 1116.388 64.233 0.03 102.004 0.000333333 1.418333333 55.96266667 1127.359667 4020 1113.104667 0.001666667 10.35533333 8/9/10 0.046666667 145.837 1909.310667 4716.872 13.54966667 PMID18248093 UBERON:feces 54.065 8.88 0.143 0.68 ENVO:human-associated habitat 7.680333333 2.746666667 2 47.57866667 0 0.581666667 10.37133333 26.57866667 1.656333333 0 1.028666667 0.045666667 CCME 49.25 474.85 chop 5.495666667 1.208666667 0.562333333 892.1746667 human gut metagenome 0 2008-01-01 00:00:00 9606 408170 149.753 3.221 2.849333333 0.080333333 0.056666667 714.8363333 2.297333333 GFIBTIE 3.718333333 97.53033333 Titanium 34.19933333 11.054 0.944 2.494666667 0 0.054 2.598666667 2.376333333 214.7456667 0.384 2.707666667 343.2566667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.37666667 1, tablespoon pyrosequencing 0.980666667 1.385 10.81533333 6.787666667 37.296 15.68 V2 CCME 0 0.021 2.280333333 169.671 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3050.01.S2.405140 ATGCGCTA CTGCTGCCTYCCGTA n 0 0.062 25.0 79.61033333 175.5473333 0.155333333 944.3096667 5.108 0.03 0.009 17.20033333 UBERON:feces 16S rRNA 0.011666667 23.27 2011 U Penn 225.0013333 0.229333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.038333333 32.11033333 52.89466667 3050 0.19 5095.171667 610.1716667 1 2009 0.873 5.479 -75.2 6.215 113 448.4273333 9987.061333 24.009 4.217666667 0.201333333 TCAG 0.237 UBERON:feces 0 1.066666667 1.407333333 0 62.962 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.048333333 0.321 1209.65 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.68733333 2.757333333 12.053 6.494666667 GAZ:United States of America 0.181 11.711 0 2009 3.708666667 0.045666667 0 0.040666667 9.698333333 0.407 9.081333333 3.199 cm 2.786 5.157 ENVO:human-associated habitat 2225.732 0.126 12.17933333 0.013333333 0 0.637666667 0.003666667 None years 4.89 9.574666667 0.642333333 PMID:21885721 human gut metagenome 0.061 0 human 177.2253333 4.266333333 43.37533333 ENVO:feces 0 5.901333333 0 264.3856667 8.658 Fisher Brand Commode Specimen Collection System 10.792 0.018 1.014666667 50.755 5726.449333 0.805333333 169.1576667 47.09566667 14.82266667 75.07533333 1.678 211.992 1.723 10818 26.53833333 0.245666667 1.258 2009 2695.540667 2.621666667 0.248666667 2010 0.0 2826.006333 9.564666667 female 2992.000667 59.99933333 0.089333333 100.8643333 0.000333333 1.888333333 47.94766667 1437.294333 3050 3627.345667 3.974666667 17.97333333 8/16/10 0.047333333 144.1926667 2096.324667 6013.64 5.98 PMID18248093 UBERON:feces 76.03633333 14.213 0.01 117.535 ENVO:human-associated habitat 8.191 2.625 25 130.382 0 1.150333333 16.403 29.11766667 2.367666667 0 1.571333333 0.024666667 CCME 74.767 488.3556667 ctrc 6.647333333 1.810333333 0.912666667 1087.376 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 160.0246667 3.752333333 4.309333333 0.086 0.142 607.63 3.349 GVJ07HB 4.289666667 90.00866667 Titanium 220.0776667 17.18533333 1.047 3.531 0 0.053 5.157 3.063333333 267.7083333 0.205333333 4.433333333 132.9676667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 21.23766667 1, tablespoon pyrosequencing 1.263333333 1.139666667 15.781 6.084333333 131.3586667 7.681666667 V2 CCME 0 0.013 3.198333333 356.549 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3034.01.S1.405213 AGTCACTG CTGCTGCCTYCCGTA n 113.2693333 0.153 24.0 90.89333333 408.78 0.055333333 1686.584 6.702333333 0.060333333 0.028666667 24.439 UBERON:feces 16S rRNA 0.027 23.27 2011 U Penn 320.6293333 0.656 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.432666667 49.009 109.4256667 3034 0.195333333 6047.554 1550.428 1 2009 2.808333333 7.263666667 -75.2 8.195333333 113 1147.54 14026.76133 31.58566667 6.142666667 0.381333333 TCAG 0.438666667 UBERON:feces 0 1.774333333 0.818333333 0 53.82133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 7.655 0.893 548.6506667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 31.48966667 5.267333333 17.627 17.63133333 GAZ:United States of America 0.608 15.54366667 0 2009 4.829666667 0.038666667 4 0.112333333 22.23366667 0.321333333 12.30466667 4.059333333 cm 3.441333333 10.152 ENVO:human-associated habitat 7426.486333 0.432 14.84166667 0.058 0 0.202333333 0.018 None years 6.184666667 12.00933333 0.788 PMID:21885721 human gut metagenome 0.184333333 35.12533333 human 296.6553333 0.167 92.26233333 ENVO:feces 0.008 12.27466667 0 362.2786667 17.61833333 Fisher Brand Commode Specimen Collection System 12.80333333 0.098 2.403 60.329 6376.595333 1.051 351.3183333 100.4836667 32.16233333 148.155 0.070666667 316.619 1.997666667 12859 50.851 0.290333333 3.291333333 2009 2756.232333 8.257333333 0.135666667 2010 0.0 3473.428 26.86766667 female 3251.902333 104.8623333 0.255 142.1056667 0.001666667 2.369333333 47.776 2423.049333 3034 1001.958 5.885 18.488 5/4/10 0.038 203.108 3107.82 10138.038 2.391333333 PMID18248093 UBERON:feces 109.0716667 16.69966667 0.031333333 147.7193333 ENVO:human-associated habitat 18.89566667 3.420666667 24 142.3813333 0 2 21.133 36.567 3.273666667 0 2.855333333 0.105333333 CCME 92.07233333 956.5003333 ctrc 19.24766667 1.510333333 1.303 2081.810667 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 272.2163333 5.453 5.616 0.268 0.218666667 1385.222333 4.14 GVJ07HB 25.45066667 76.926 Titanium 287.0143333 34.09666667 2.686 4.494666667 0 0.124333333 10.152 4.026 447.995 0.818 9.718 1019.045 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.70766667 1, tablespoon pyrosequencing 3.105 2.846333333 34.673 8.296333333 486.343 15.11833333 V2 CCME 0 0.043333333 4.213 806.9723333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4020.01.S1.405129 GACTACTG CTGCTGCCTYCCGTA n 0 0.066 2.0 48.964 84.17233333 0.002666667 728.1016667 5.126666667 0.052666667 0.011666667 14.55133333 UBERON:feces 16S rRNA 2.91 23.27 2011 U Penn 132.3746667 0.208333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.641333333 22.55066667 212.272 4020 0.012 2869.116667 617.7156667 None 2009 0.959666667 3.762666667 -75.2 4.937 103 195.6793333 6634.971 25.37466667 2.197333333 0.055333333 TCAG 0.099333333 UBERON:feces 0 0.963333333 0.955666667 0.002333333 68.217 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.459333333 0.229 636.5123333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 13.10233333 1.922 9.422333333 12.92966667 GAZ:United States of America 0.177666667 21.68766667 11.81066667 2010 2.489666667 0.006666667 3 0.023333333 8.752 0.133 19.821 2.22 emd 1.983666667 7.913666667 ENVO:human-associated habitat 752.1113333 0.134333333 8.116 0.002 0 0.104 0.002666667 None years 3.438 8.598 0.822 PMID:21885721 human gut metagenome 23.90566667 0 human 164.3126667 0.065 25.26166667 ENVO:feces 0.000333333 15.93366667 0 162.1383333 5.893666667 Fisher Brand Commode Specimen Collection System 8.913333333 0.048666667 0.297333333 23.874 3293.509 0.567 48.599 33.50033333 10.27833333 84.14233333 0.04 101.2593333 1 5530 15.98666667 0.174333333 7.822333333 2010 875.7606667 6.123 23.44366667 2010 0.0 1958.083333 9.93 male 1116.388 64.233 0.03 102.004 0.000333333 1.418333333 55.96266667 1127.359667 4020 1113.104667 0.001666667 10.35533333 8/9/10 0.046666667 145.837 1909.310667 4716.872 13.54966667 PMID18248093 UBERON:feces 54.065 8.88 0.143 0.68 ENVO:human-associated habitat 7.680333333 2.746666667 2 47.57866667 0 0.581666667 10.37133333 26.57866667 1.656333333 0 1.028666667 0.045666667 CCME 49.25 474.85 chop 5.495666667 1.208666667 0.562333333 892.1746667 human gut metagenome 0 2008-01-01 00:00:00 9606 408170 149.753 3.221 2.849333333 0.080333333 0.056666667 714.8363333 2.297333333 GFIBTIE 3.718333333 97.53033333 Titanium 34.19933333 11.054 0.944 2.494666667 0 0.054 2.598666667 2.376333333 214.7456667 0.384 2.707666667 343.2566667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.37666667 1, tablespoon pyrosequencing 0.980666667 1.385 10.81533333 6.787666667 37.296 15.68 V2 CCME 0 0.021 2.280333333 169.671 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3037.01.S1.405123 AGTCAGTC CTGCTGCCTYCCGTA n 60.73933333 0.079666667 23.0 137.557 175.3003333 0.009 1362.972667 9.066666667 0.070666667 0.013333333 26.45933333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 277.6856667 1.326666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.086333333 60.77666667 10.904 3037 0.039 1118.014333 1340.323667 1 2009 1.937666667 5.249666667 -75.2 5.965 107 1866.332667 6057.157333 35.032 17.51633333 0.248333333 TCAG 0.058666667 UBERON:feces 0 2.8 1.337 0 64.33433333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 15.26566667 0.329 42.94333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 47.89 7.702333333 17.294 11.22566667 GAZ:United States of America 0.311333333 24.58966667 40 2009 3.407666667 0.013 4 0.133333333 19.99066667 0.03 19.61466667 3.170666667 cm 2.466 23.60766667 ENVO:human-associated habitat 732.0346667 0.159 11.891 0.003666667 0 0.189666667 0.027666667 None years 4.211 8.879333333 1.086 PMID:21885721 human gut metagenome 0.156 0 human 248.879 7.316 21.24566667 ENVO:feces 0 47.04866667 0 304.813 10.95633333 Fisher Brand Commode Specimen Collection System 12.10266667 0.033 0.741666667 36.79066667 1144.999 0.773 67.22966667 72.819 26.023 76.82466667 2.694333333 279.894 1.496666667 9969 34.10666667 0.410333333 1.595666667 2009 2661.130333 11.072 0.086 2010 0.0 2732.552667 39.641 male 3047.915667 70.75866667 0.162 142.3683333 0.002666667 1.898 50.47 1943.792333 3037 2799.916667 0.136666667 11.009 5/11/10 0.028666667 203.4973333 1967.393667 8132.828 4.616 PMID18248093 UBERON:feces 126.1596667 14.09766667 0.045333333 14.36133333 ENVO:human-associated habitat 17.78166667 1.248 23 173.267 0 3.507333333 16.52166667 32.07366667 2.28 0 3.984333333 0.026666667 CCME 71.823 881.708 ctrc 26.89066667 1.826666667 1.163666667 1435.740333 human gut metagenome 0 1987-01-01 00:00:00 9606 408170 222.4196667 4.310666667 4.642333333 0.199 0.158333333 1050.920667 3.026666667 GVJ07HB 6.568666667 91.95866667 Titanium 209.0976667 27.67133333 1.584666667 3.182666667 0 0.066 5.607666667 3.204 442.466 0.755666667 4.256666667 1244.907333 16 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.73633333 1, tablespoon pyrosequencing 1.999 4.357 19.91266667 8.799333333 816.8246667 48.35733333 V2 CCME 0 0.006 3.311333333 1094.510333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4013.01.P1.405166 CACAGTGT CTGCTGCCTYCCGTA n 0 0.033333333 19.0 85.97266667 197.699 0.003 634.7253333 1.646333333 0.013666667 0.005666667 7.559666667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 174.3293333 0.211666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.632666667 13.768 6.353 4013 0.011333333 2847.194667 481.4206667 1 2009 0.268666667 2.820666667 -75.2 2.902333333 113 188.9826667 5615.061667 8.411666667 2.654666667 0.060333333 TCAG 0.075666667 UBERON:feces 0 0.701333333 0.467666667 0.002666667 56.84933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.313666667 0.157666667 71.491 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 7.141666667 1.750666667 5.940333333 0.959333333 GAZ:United States of America 0.333666667 7.090666667 0 2009 1.879666667 0.005666667 0 0.009333333 2.733666667 0.008 7.408333333 1.545333333 dhc 1.212666667 2.232666667 ENVO:human-associated habitat 2862.614 0.097333333 5.807666667 0 0 0.065 0.000666667 None years 2.447333333 7.192 1.094333333 PMID:21885721 human gut metagenome 0.14 0 human 89.09966667 0 31.54266667 ENVO:feces 0 2.361 0 116.7023333 3.260666667 Fisher Brand Commode Specimen Collection System 6.108333333 0.038666667 0 27.76 2886.116333 0.397666667 137.5066667 16.73833333 4.996 61.468 0 53.93966667 0.756 4073 9.313666667 0.088 0.118333333 2009 2896.329333 1.947333333 0.073 2010 0.0 1123.610333 3.845 female 3047.088 28.74733333 0.034 46.63566667 0.071 0.906666667 59.86533333 635.2246667 4013 1131.518333 0.265666667 4.257666667 3/12/10 0.012666667 66.67366667 1613.875333 2657.778667 0.935666667 PMID18248093 UBERON:feces 16.86633333 6.577 0 50.25066667 ENVO:human-associated habitat 2.362 1.353 19 45.32466667 0 0.472 9.966666667 19.06533333 1.288333333 0 1.142666667 0.005 CCME 36.16966667 198.213 chop 4.08 0.664333333 0.390333333 721.9303333 human gut metagenome 0 1991-01-01 00:00:00 9606 408170 81.54 1.572666667 2.577333333 0.095333333 0.039666667 598.2903333 1.596333333 GFIBTIE 14.42533333 81.275 Titanium 145.942 5.523333333 0.592 1.576 0 0.027666667 2.232666667 1.277333333 162.6063333 0.078333333 1.619 240.911 28.475 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 21.177 1, tablespoon pyrosequencing 0.288333333 0.811 6.551333333 3.556666667 8.64 3.315 V2 CCME 0 0.008 1.683666667 182.9693333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4029.01.S1.405210 GATCGTAC CTGCTGCCTYCCGTA n 33.98066667 0.020666667 19.0 259.1956667 706.3056667 0.001333333 1809.487667 23.81366667 0.018 0.003666667 63.04766667 UBERON:feces 16S rRNA 0.840666667 23.27 2011 U Penn 599.8686667 0.442333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.367333333 44.46366667 270.612 4029 0.002 8742.496333 1084.526 1 2009 3.638666667 5.509333333 -75.2 6.787666667 107 1242.027333 16012.85267 72.217 11.91633333 0.246666667 TCAG 1.838666667 UBERON:feces 0 3.346333333 0.118666667 0.002666667 57.66366667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.794 0.178 95.33033333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 28.68633333 11.56466667 39.076 21.138 GAZ:United States of America 0.144666667 40.73566667 19.418 2009 3.754666667 0.008666667 5 0.150666667 31.514 1.104666667 50.05266667 3.825 cm 2.573666667 25.341 ENVO:human-associated habitat 7801.484333 0.088666667 13.36333333 0.008 0.002 0.968333333 0.012333333 None years 3.212 4.567666667 2.385666667 PMID:21885721 human gut metagenome 5.557333333 10.53766667 human 458.5506667 0 67.07266667 ENVO:feces 0.001 38.57433333 0 278.83 9.579333333 Fisher Brand Commode Specimen Collection System 12.33566667 0.004666667 0.241666667 6.204333333 8925.467667 0.946666667 361.2546667 94.686 39.54333333 175.054 0 38.05866667 1.196 3626 17.17833333 0.108 2.197333333 2009 4105.770667 5.164333333 4.634666667 2010 0.0 2257.692 23.54 male 4728.548333 81.50733333 0.158 227.6853333 0.002 1.801 62.097 2843.345 4029 12059.81133 3.823 0 5/11/10 0.132666667 325.4783333 4866.328 11896.55567 13.42866667 PMID18248093 UBERON:feces 195.19 18.66033333 0.050333333 554.6013333 ENVO:human-associated habitat 27.812 9.932333333 19 146.2033333 0 3.176333333 29.68233333 28.26333333 2.186666667 0 3.785 0.012333333 CCME 78.42966667 2707.562 citric 14.93166667 0.260333333 0.634666667 1828.315333 human gut metagenome 0 1991-01-01 00:00:00 9606 408170 395.5033333 4.974 5.484 0.07 0.009333333 1171.816667 3.041666667 GVJ07HB 2.795666667 82.43066667 Titanium 632.3743333 40.68866667 0.663333333 3.235666667 0 0.017 16.603 3.343 862.806 1.044 3.348 340.7373333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 9.631666667 1, tablespoon pyrosequencing 3.651333333 2.787333333 15.124 9.181666667 377.6996667 44.11533333 V2 CCME 0 0.054 3.712333333 977.5683333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3041.01.S2.405191 AGTGACTC CTGCTGCCTYCCGTA n 0 0.045666667 43.0 35.542 77.65133333 0.001666667 664.875 2.094666667 0.034333333 0.007333333 7.428 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 70.59533333 4.628 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.634666667 21.891 6.259 3041 0.008333333 559.1173333 646.2733333 1 2009 0.593333333 2.463333333 -75.2 2.238 114 450.298 2943.167 15.538 2.156666667 0.096333333 TCAG 0.130333333 UBERON:feces 0 0.652 3.057666667 0.001333333 59.348 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.780333333 0.334 9.944 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 15.807 2.584333333 5.271333333 11.89166667 GAZ:United States of America 0.682 36.16833333 0 2009 1.582 0 0 0.023333333 6.914666667 0.289333333 21.32433333 1.439666667 cm 0.999 2.945 ENVO:human-associated habitat 243.6873333 0.205666667 4.996666667 0.033333333 0 0.076 0.000666667 None years 1.639666667 12.197 0.352666667 PMID:21885721 human gut metagenome 0.252333333 0 human 241.678 0.074666667 58.67266667 ENVO:feces 0 4.326 0 143.9993333 7.464 Fisher Brand Commode Specimen Collection System 10.472 0.014333333 0.000666667 15.46033333 567.2186667 0.365 26.53666667 48.263 17.14633333 133.552 0.038333333 134.5536667 0.595 11723 27.148 0.156 1.734666667 2009 1268.300667 3.203 0.082 2010 0.0 1948.967 12.766 female 1590.341667 111.294 0.068333333 139.3423333 0.077 0.752 62.87166667 1510.711 3041 620.3503333 2.707333333 0.921 6/3/10 0.046 199.146 1276.905333 6320.815 4.855666667 PMID18248093 UBERON:feces 94.719 7.480333333 0.001333333 78.85833333 ENVO:human-associated habitat 6.255666667 0.598666667 43 55.16466667 0 1.476 9.718666667 28.75566667 1.063333333 0 1.873 0.012666667 CCME 31.222 361.5383333 ctrc 8.428333333 3.253666667 0.357666667 693.5413333 human gut metagenome 0 1967-01-01 00:00:00 9606 408170 234.2496667 1.363666667 2.761333333 0.646333333 0.041 563.6616667 1.351333333 GVJ07HB 12.45566667 84.821 Titanium 129.5586667 17.71866667 2.601333333 1.162666667 0 0.038333333 2.945 0.983333333 129.7483333 0.434666667 3.410333333 599.005 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 8.385333333 1, tablespoon pyrosequencing 0.603333333 1.288666667 20.21866667 4.023666667 223.5596667 4.385666667 V2 CCME 0 0.004666667 1.541333333 293.8493333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3040.01.S1.405189 AGTCTGAC CTGCTGCCTYCCGTA n 0 0.161666667 24.0 163.5936667 516.077 0.001 1797.562333 11.557 0.106666667 0.019333333 38.84566667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 454.5163333 0.469 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.308666667 48.21 298.4006667 3040 0.003 880.8166667 448.665 1 2009 2.187 7.480333333 -75.2 8.460333333 107 1059.142333 2982.789 52.34366667 4.740333333 0.160333333 TCAG 0.351333333 UBERON:feces 0 2.107666667 2.709 0.000666667 56.93966667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.601333333 1.054666667 77.24333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 26.18133333 4.684333333 26.454 21.46366667 GAZ:United States of America 0.562 27.401 0 2009 4.955333333 0.002 5 0.072333333 19.71 0.048333333 27.268 4.681666667 cm 3.519333333 8.487333333 ENVO:human-associated habitat 596.4503333 0.326666667 15.926 0.005 0 0.518666667 0.068666667 None years 5.377666667 11.18433333 0.604 PMID:21885721 human gut metagenome 0.677 0 human 370.0083333 0 34.14666667 ENVO:feces 0 10.902 0 273.1316667 15.657 Fisher Brand Commode Specimen Collection System 8.923333333 0.031 1.844333333 46.11433333 1068.638333 1.321666667 64.572 82.112 24.89433333 101.6296667 0 131.6906667 1.945333333 11405 36.44233333 0.575666667 4.519333333 2009 2367.877 5.325666667 0.095666667 2010 0.0 6233.027667 26.89833333 male 2878.936 52.49433333 0.130666667 180.9066667 0.006666667 2.554333333 55.597 2575.557 3040 17376.34233 0.699333333 6.236666667 6/3/10 0.081666667 258.5523333 3528.263333 10776.131 3.496666667 PMID18248093 UBERON:feces 210.9706667 21.79433333 0.106 22.746 ENVO:human-associated habitat 17.466 4.112666667 24 122.004 0 2.716666667 28.70866667 28.107 3.443 0 2.504 0.079 CCME 98.588 921.5483333 ctrc 15.80266667 3.314666667 1.157333333 537.718 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 330.9513333 4.768 7.997333333 0.265333333 0.024666667 1675.006 4.303666667 GVJ07HB 8.799333333 81.37133333 Titanium 222.229 26.842 3.272333333 3.856666667 0 0.142 8.487333333 3.59 391.851 0.558666667 7.247333333 359.6116667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.31366667 1, tablespoon pyrosequencing 2.192666667 2.37 29.56233333 6.021333333 355.8133333 12.63266667 V2 CCME 0 0.010333333 4.402 810.383 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3004.01.P1.405192 AGACTCTG CTGCTGCCTYCCGTA n 0 0.064666667 24.0 59.74333333 99.23266667 0.066333333 885.0976667 3.076333333 0.039333333 0.009333333 12.22133333 UBERON:feces 16S rRNA 0.781666667 23.27 2011 U Penn 221.9876667 0.724333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.833666667 30.03166667 28.97833333 3004 0.230333333 2863.899667 549.855 1 2009 0.985333333 4.011666667 -75.2 4.331 113 701.551 6449.591333 24.41433333 3.834666667 0.151 TCAG 0.437333333 UBERON:feces 0 1.080666667 1.361666667 0 62.85033333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.903 0.235666667 893.5863333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 20.45 3.289 9.084666667 6.566333333 GAZ:United States of America 0.232 13.78 9.954333333 2009 2.685333333 0.062333333 5 0.055333333 8.167 0.212 11.80866667 2.325 cm 1.887 10.00333333 ENVO:human-associated habitat 1098.773 0.112666667 8.537 0.055333333 0 0.062666667 0 None years 3.132666667 6.222 0.689666667 PMID:21885721 human gut metagenome 3.166666667 0 human 255.8133333 42.101 66.25133333 ENVO:feces 0.016333333 16.25866667 0 199.4303333 7.475 Fisher Brand Commode Specimen Collection System 8.362 0.037333333 0.000333333 27.89933333 3325.189 0.574666667 73.18566667 44.70733333 17.99666667 109.402 10.18766667 114.1336667 1.107 8513 19.84266667 0.257 2.250333333 2009 2355.523333 3.606 2.839333333 2009 0.0 3160.507333 15.95166667 female 2743.274333 81.51466667 0.099333333 151.822 0.094666667 1.283666667 58.14733333 1907.990333 3004 1593.14 4.746666667 7.07 12/17/09 0.121333333 216.994 1963.053333 7983.031 2.603666667 PMID18248093 UBERON:feces 119.0473333 11.19666667 0.021333333 68.212 ENVO:human-associated habitat 6.662 1.779 24 84.70566667 0 1.478333333 15.06566667 20.25566667 1.698666667 0 1.738666667 0.032666667 CCME 52.31666667 402.371 ctrc 7.756666667 1.753333333 0.644 826.9543333 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 243.5923333 2.535333333 3.798 0.128333333 0.095333333 733.5863333 2.293666667 GFIBTIE 14.89633333 89.83 Titanium 93.506 19.07266667 1.098666667 2.299666667 0 0.055333333 5.524 1.973666667 229.9446667 0.252 3.657666667 272.7563333 28.33333333 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 11.41833333 1, tablespoon pyrosequencing 1.360666667 1.521666667 13.99633333 4.093 282.0386667 18.18633333 V2 CCME 0 0.04 2.395333333 504.0263333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3051.01.S1.405138 CAGTAGTC CTGCTGCCTYCCGTA n 0 0.111333333 28.0 123.3426667 148.1846667 0.012 1295.909 7.374666667 0.042333333 0.012333333 21.34333333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 270.4786667 0.321333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.111333333 44.97166667 47.898 3051 0.048 1009.292667 329.9553333 1 2009 2.111666667 6.093333333 -75.2 6.392666667 107 795.166 2578.774333 38.56833333 4.590666667 0.116 TCAG 0.212333333 UBERON:feces 0 1.232333333 1.01 0 56.691 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.296333333 0.728 64.19733333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 26.54733333 3.121666667 13.623 18.51333333 GAZ:United States of America 0.376333333 29.68666667 0 2009 4.051 0.007 2 0.094666667 21.77833333 0.166333333 31.361 3.725333333 cm 2.958333333 8.017666667 ENVO:human-associated habitat 997.438 0.218666667 13.76833333 0.001333333 0 0.387 0 None years 4.247333333 8.461 0.956333333 PMID:21885721 human gut metagenome 0.021 0 human 300.1463333 27.799 15.645 ENVO:feces 0 10.123 0 322.082 12.97733333 Fisher Brand Commode Specimen Collection System 7.66 0.015 0 45.468 1065.340667 1.105666667 127.5823333 69.65833333 18.35033333 81.72533333 5.772 250.9753333 1.714 12660 35.227 0.416333333 5.128 2009 2988.07 3.344333333 0.161333333 2010 0.0 3843.625 15.10033333 male 3423.154333 49.78766667 0.116666667 168.5533333 0 2.075666667 52.85333333 2330.259333 3051 10376.87867 0.655666667 9.855666667 8/19/10 0.069666667 240.915 2336.926333 9749.805667 3.769 PMID18248093 UBERON:feces 162.8373333 18.80866667 0 113.7113333 ENVO:human-associated habitat 19.478 2.704333333 28 161.2233333 0 2.111333333 20.79566667 25.72 2.802333333 0 2.131333333 0.023666667 CCME 84.16866667 541.6613333 ctrc 9.426666667 1.485333333 1.048666667 418.7336667 human gut metagenome 0 1982-01-01 00:00:00 9606 408170 278.8026667 3.407666667 6.944 0.170333333 0.091 1041.056 3.513333333 GVJ07HB 0.876666667 81.02833333 Titanium 281.8893333 19.834 2.210666667 3.318666667 0 0.098666667 8.017666667 2.926 299.9913333 0.509666667 4.961333333 241.177 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.84333333 1, tablespoon pyrosequencing 2.179 1.819 22.45366667 7.359 308.4233333 11.94933333 V2 CCME 0 0.027666667 3.549666667 578.93 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3027.01.P1.405133 GCATCGAT CTGCTGCCTYCCGTA n 0 0.274666667 42.0 130.2263333 369.5806667 0.494 1630.890667 8.819 0.191666667 0.061666667 32.389 UBERON:feces 16S rRNA 0.244333333 23.27 2011 U Penn 406.9586667 1.537666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.579 69.40933333 494.707 3027 1.631666667 11101.56533 1396.590667 1 2009 3.090333333 9.144666667 -75.2 11.27166667 108 922.5866667 21206.45867 47.34233333 8.381 0.916333333 TCAG 0.756333333 UBERON:feces 0 2.735333333 2.222333333 0 62.07766667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 11.85 0.937333333 1137.515333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 46.04133333 5.004 23.29533333 18.796 GAZ:United States of America 0.765333333 15.08666667 0 2009 6.086 0.397333333 4 0.112 29.69866667 0.365333333 18.25133333 5.299333333 cm 4.703666667 16.64633333 ENVO:human-associated habitat 4901.757333 0.522333333 19.971 0.401 0 0.205333333 0.002666667 None years 8.277666667 11.604 0.776333333 PMID:21885721 human gut metagenome 2.049 0 human 359.3743333 4.633333333 42.13833333 ENVO:feces 0.113 19.18366667 0 457.0606667 22.093 Fisher Brand Commode Specimen Collection System 14.966 0.074666667 0.002666667 75.178 11917.67667 1.401666667 262.3166667 136.0823333 48.973 80.40566667 0.985 475.4403333 2.736666667 12445 66.16133333 0.455666667 2.622666667 2009 2671.361 6.879666667 1.454666667 2010 0.0 5292.651667 21.202 male 3250.797333 25.19333333 0.296 205.5653333 0.014 3.410333333 45.00466667 3132.873667 3027 1640.855333 0.091666667 29.23133333 3/23/10 0.020666667 293.8553333 4806.851 13107.94333 2.574333333 PMID18248093 UBERON:feces 225.99 25.12966667 0.027 72.02933333 ENVO:human-associated habitat 23.34533333 6.677 42 202.7293333 0 2.741333333 30.36433333 38.225 4.143666667 0 2.916666667 0.078 CCME 122.5283333 1163.141 ctrc 13.695 2.806666667 2.034 2389.730667 human gut metagenome 0 1968-01-01 00:00:00 9606 408170 326.985 7.316333333 6.885 0.437333333 0.51 769.7453333 5.336 GFIBTIE 2.149 88.73866667 Titanium 351.673 52.64166667 3.635 5.918666667 0 0.227 16.64633333 5.278666667 463.6733333 1.577666667 10.74433333 403.4513333 265.0573333 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.85533333 1, tablespoon pyrosequencing 5.725666667 3.815666667 41.96966667 8.317666667 303.166 24.821 V2 CCME 0 0.036333333 5.432 710.125 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3065.01.S1.405201 CATGTGCA CTGCTGCCTYCCGTA n 107.2083333 0.153333333 27.0 43.631 184.327 0.092 1375.586 3.7 0.065 0.029333333 15.02166667 UBERON:feces 16S rRNA 0.040666667 23.27 2011 U Penn 225.3866667 1.641333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.551666667 48.108 24.29866667 3065 0.117 3471.841333 675.105 1 2009 2.585 8.26 -75.2 9.231333333 113 638.4753333 7347.765333 28.48533333 4.933 0.196333333 TCAG 0.418666667 UBERON:feces 0 1.995666667 2.941 0.000333333 65.038 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.834333333 0.607666667 373.4513333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 27.95366667 3.782666667 11.04833333 24.441 GAZ:United States of America 0.575333333 12.75166667 0 2009 5.417 0.026333333 4 0.117333333 23.83566667 0.268666667 7.361333333 4.815333333 cm 4.162333333 8.954666667 ENVO:human-associated habitat 1919.021667 0.328666667 17.32566667 0.011333333 0 0.346333333 0.000666667 None years 7.391333333 10.606 0.771333333 PMID:21885721 human gut metagenome 0.222666667 0 human 286.7806667 10.60666667 57.231 ENVO:feces 0.004 11.65566667 0 456.107 16.53433333 Fisher Brand Commode Specimen Collection System 11.27333333 0.030333333 0 78.13333333 3670.716667 1.209333333 191.66 94.98566667 30.41633333 86.209 3.778666667 551.3856667 2.583666667 10210 58.83266667 0.625333333 7.583333333 2009 1971.251667 6.353 0.214 2010 0.0 4415.283667 16.22966667 female 2414.454 72.30133333 0.158666667 177.485 0.000333333 2.863333333 46.45233333 2502.987 3065 6484.178667 0.920333333 25.36933333 9/13/10 0.080666667 253.7316667 2466.552 10472.49733 2.893333333 PMID18248093 UBERON:feces 170.87 20.771 0.009333333 38.40366667 ENVO:human-associated habitat 20.737 1.466333333 27 183.3133333 0 1.776333333 19.46033333 32.65833333 3.610333333 0 1.849333333 0.076333333 CCME 106.6113333 384.2033333 ctrc 13.19966667 3.626333333 1.307666667 980.998 human gut metagenome 0 1983-01-01 00:00:00 9606 408170 270.855 6.179333333 6.391666667 0.342 0.214 815.0263333 5.007 GVJ07HB 5.625666667 92.971 Titanium 230.5733333 32.17 2.655333333 5.27 0 0.125 8.954666667 4.757 252.0013333 0.450666667 7.663666667 369.2116667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.041 1, tablespoon pyrosequencing 2.824 1.611666667 30.95366667 8.049333333 242.873 13.35933333 V2 CCME 0 0.068 4.782 468.2596667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3079.01.S3.405126 CTGACTGA CTGCTGCCTYCCGTA n 0 0.065666667 39.0 189.7666667 229.34 0.013666667 1297.602 5.975 0.020666667 0.011666667 24.11666667 UBERON:feces 16S rRNA 0.378666667 23.27 2011 U Penn 471.7896667 0.275 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.188333333 35.92133333 216.229 3079 0.057666667 10295.47767 1130.674667 1 2009 1.255333333 5.675 -75.2 6.600333333 114 524.542 19704.03 34.78833333 5.363 0.164333333 TCAG 0.413333333 UBERON:feces 0 1.532333333 0.586333333 0 55.37266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.071666667 0.312666667 2141.744 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 22.639 3.882333333 17.98433333 7.658333333 GAZ:United States of America 0.252666667 8.652333333 0 2009 3.614666667 0.002333333 0 0.043666667 9.530333333 0.012666667 8.589333333 3.197333333 cm 2.667333333 10.11666667 ENVO:human-associated habitat 5466.117 0.180666667 12.283 0.260666667 0 0.325 0 None years 4.902 7.630666667 0.754666667 PMID:21885721 human gut metagenome 2.201333333 0 human 197.0916667 12.29666667 25.23066667 ENVO:feces 0.003333333 11.02533333 0 312.4533333 7.278 Fisher Brand Commode Specimen Collection System 9.551333333 0.015333333 0.089 39.13533333 11474.46567 0.797 404.1543333 41.384 14.58366667 62.12633333 5.650666667 103.2966667 1.469333333 5404 17.95233333 0.161333333 1.302333333 2009 3205.144 3.321 2.326 2010 0.0 3619.674333 11.64166667 female 3541.261 22.70766667 0.065666667 96.76166667 0.066 2.042333333 50.42666667 1498.488 3079 3106.097667 0.014 14.92566667 9/30/10 0.234333333 138.2946667 3482.726667 6269.673667 0.764666667 PMID18248093 UBERON:feces 94.23166667 16.65533333 0.024333333 74.19733333 ENVO:human-associated habitat 8.094 4.200333333 39 101.4236667 0 1.433 21.84833333 24.96966667 2.422333333 0 1.937333333 0.038333333 CCME 73.83633333 586.9323333 ctrc 7.806666667 0.793 0.646 2086.880667 human gut metagenome 0 1979-01-01 00:00:00 9606 408170 172.971 4.031666667 4.547 0.108666667 0.039 928.8863333 3.171666667 GVJ07HB 18.56466667 79.14266667 Titanium 178.545 15.79966667 1.200666667 3.277 0 0.054333333 10.11666667 2.774 328.941 0.326 2.782666667 174.4696667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 19.009 1, tablespoon pyrosequencing 1.332333333 1.813 12.66066667 5.769666667 30.98433333 15.06133333 V2 CCME 0 0.022666667 3.358 502.774 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4011.01.P1.405200 ATGCTAGC CTGCTGCCTYCCGTA n 0 0.084333333 11.0 87.11633333 122.464 0.001333333 698.2743333 4.686333333 0.138 0.014333333 12.084 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 130.1736667 0.215 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.681333333 22.887 230.3416667 4011 0.008666667 831.8503333 422.3366667 1 2009 0.414 3.676666667 -75.2 4.222666667 111 369.7903333 2805.195667 15.527 2.696333333 0.080666667 TCAG 0.197333333 UBERON:feces 0 0.728666667 2.996333333 0.001 56.935 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.571666667 0.353666667 119.0526667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.76266667 1.797666667 7.316333333 5.697333333 GAZ:United States of America 0.220666667 11.56033333 0 2009 2.414333333 0.005666667 0 0.014 4.338 0.790333333 16.571 2.046333333 vb 1.736333333 3.465666667 ENVO:human-associated habitat 1275.246667 0.141333333 7.827666667 0.046666667 0 0.306333333 0 None years 3.239333333 11.50933333 0.349333333 PMID:21885721 human gut metagenome 0.068666667 0 human 138.517 0 22.42 ENVO:feces 0 4.117 0 159.264 7.211333333 Fisher Brand Commode Specimen Collection System 11.20033333 0.028666667 0 32.735 1007.168 0.487666667 69.98333333 35.38766667 12.58966667 59.24966667 0 109.3626667 1.053666667 2531 19.49233333 0.409 0.559333333 2009 1202.959 2.996 0.027333333 2010 0.0 2010.999667 12.595 female 1408.855333 25.167 0.043 71.592 0.039666667 1.315666667 52.14366667 1053.248 4011 4922.344667 0 12.14633333 3/11/10 0.129666667 102.316 1609.462 4406.789 2.862 PMID18248093 UBERON:feces 61.16833333 9.496666667 0 0.607333333 ENVO:human-associated habitat 3.82 2.208 11 66.884 0 0.972666667 10.31333333 29.08933333 1.574 0 1.190666667 0.102666667 CCME 48.262 375.731 chop 8.608666667 3.439 0.701666667 506.2673333 human gut metagenome 0 1999-01-01 00:00:00 9606 408170 126.4326667 2.536333333 3.324 0.109666667 0.058333333 567.2216667 2.112666667 GFIBTIE 5.529333333 81.367 Titanium 117.0436667 13.795 1.317333333 2.334666667 0 0.07 3.465666667 2.285666667 164.9616667 0.190666667 3.805333333 338.406 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.64033333 1, tablespoon pyrosequencing 0.429666667 1.393333333 13.88533333 3.677666667 140.9163333 5.16 V2 CCME 0 0.002333333 2.047666667 271.09 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4024.01.S3.405152 GACTGTCA CTGCTGCCTYCCGTA n 0 0.16 6.0 25.75133333 64.58833333 0.002666667 1075.75 3.587 0.208333333 0.022666667 13.79166667 UBERON:feces 16S rRNA 0.03 23.27 2011 U Penn 104.797 0.584 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.821 23.76933333 33.74533333 4024 0.006666667 459.6866667 481.7303333 None 2009 0.787 4.639 -75.2 4.327666667 104 296.517 2292.880667 17.10966667 3.175 0.188333333 TCAG 0.966 UBERON:feces 0 0.612666667 4.988666667 0 59.76166667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.499666667 0.748666667 37.49166667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 12.83866667 2.219666667 10.05933333 14.04833333 GAZ:United States of America 0.504333333 23.042 0 2010 2.944333333 0.000666667 3 0.057666667 9.643 1.172 26.81666667 2.500666667 dhc 1.974666667 3.723333333 ENVO:human-associated habitat 697.4683333 0.298666667 9.022666667 0.050666667 0 0.218333333 0.000333333 None years 3.507666667 14.815 0.362666667 PMID:21885721 human gut metagenome 0.389333333 0 human 197.5963333 0 28.00866667 ENVO:feces 0.007666667 5.31 0 192.3126667 13.73066667 Fisher Brand Commode Specimen Collection System 15.503 0.035 0.000333333 39 495.3053333 0.656 31.01633333 69.173 24.60466667 96.22933333 0 199.3026667 1.234333333 3952 37.38766667 0.581333333 1.488333333 2010 1041.764 4.696666667 0.389333333 2010 0.0 3215.042 9.991666667 female 1354.867667 54.59866667 0.092 109.3876667 0 1.513333333 48.17866667 1612.350667 4024 4313.690333 0.113 6.235666667 4/19/10 0.044333333 156.3106667 1529.558333 6746.073667 2.184 PMID18248093 UBERON:feces 80.238 11.77433333 0.002 18.38833333 ENVO:human-associated habitat 8.543333333 1.454333333 6 67.68933333 0 1.108333333 14.34466667 37.923 2.102666667 0 1.724333333 0.168666667 CCME 56.118 576.7096667 chop 8.945666667 5.616666667 1.467666667 523.0056667 human gut metagenome 0 2004-01-01 00:00:00 9606 408170 183.1946667 2.424 4.570333333 0.250666667 0.054666667 955.5193333 2.487333333 GVJ07HB 15.96 85.397 Titanium 100.715 28.074 2.713333333 2.336 0 0.137333333 3.723333333 1.866333333 174.619 0.417666667 7.002 440.4546667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.963 1, tablespoon pyrosequencing 0.804666667 0.918 27.151 5.310666667 112.671 5.534 V2 CCME 0 0.013333333 2.592333333 217.5526667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3066.01.S1.405211 CGATATGC CTGCTGCCTYCCGTA n 0 0.066666667 25.0 124.5656667 600.9656667 0.019666667 2653.636667 10.534 0.639333333 0.017666667 66.97833333 UBERON:feces 16S rRNA 2.313 23.27 2011 U Penn 575.5923333 0.188666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.893333333 84.54333333 101.934 3066 0.026666667 4675.254333 1010.161667 1 2009 0.982 10.04033333 -75.2 13.47933333 113 1395.476 10732.95133 97.95166667 10.982 1.615333333 TCAG 1.602333333 UBERON:feces 0 3.733666667 0.903 0.002333333 60.7 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 70.07933333 0.187 1155.367667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 59.15233333 14.36633333 55.37633333 20.141 GAZ:United States of America 0.130666667 29.89633333 8.552666667 2009 6.606666667 0.018 4 0.569333333 30.66 0.709666667 33.373 6.340666667 cm 5.027 30.80566667 ENVO:human-associated habitat 2454.974333 0.078333333 24.191 0.083666667 0 1.432666667 0.082333333 None years 7.924666667 5.055333333 1.680666667 PMID:21885721 human gut metagenome 15.12866667 0 human 441.2886667 0.790666667 30.38433333 ENVO:feces 0 37.912 0 480.99 12.52833333 Fisher Brand Commode Specimen Collection System 14.51833333 0.019666667 5.621666667 46.32733333 5303.905333 1.523333333 143.2453333 114.9103333 48.97466667 113.4743333 0.1 138.4823333 2.492 11808 26.82233333 0.178666667 2.11 2009 3449.547667 7.137666667 9.703666667 2010 0.0 5142.1 46.85333333 female 4166.550667 56.00633333 0.322333333 225.056 0.008 3.607666667 53.02766667 3250.362 3066 8786.389333 1.777333333 17.895 9/16/10 0.159333333 321.7393333 4808.880333 13599.51433 11.962 PMID18248093 UBERON:feces 231.961 26.725 0.294333333 0 ENVO:human-associated habitat 28.84466667 5.883333333 25 182.132 0 3.298333333 33.33833333 30.04533333 4.263333333 0 3.53 0.095666667 CCME 144.2956667 3665.576 ctrc 29.838 1.321333333 0.84 1452.154 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 374.3106667 9.826666667 7.311 0.05 0.090333333 1861.878 5.841 GVJ07HB 6.426333333 86.77633333 Titanium 334.8583333 55.359 0.743666667 6.492 0 0.047 26.95733333 6.45 951.1153333 0.918666667 3.994333333 568.1696667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.836 1, tablespoon pyrosequencing 1.046 5.252666667 19.701 8.097 482.2256667 48.72533333 V2 CCME 0 0.030333333 6.247666667 1057.818 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4021.01.S3.405157 GACTCAGT CTGCTGCCTYCCGTA n 0 0.153333333 9.0 65.924 111.841 0.005 1313.605333 3.247 0.073 0.034333333 12.98966667 UBERON:feces 16S rRNA 0.318 23.27 2011 U Penn 183.8813333 0.448333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.46 42.21766667 8.885 4021 0.023 3939.396333 1525.138 1 2009 0.622333333 6.201 -75.2 6.968 105 446.2873333 11609.92867 19.96266667 4.353333333 0.229333333 TCAG 0.258666667 UBERON:feces 0 1.028666667 1.508666667 0.002666667 59.142 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 12.60533333 0.501 1513.503 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 27.46433333 3.043 9.743666667 4.599 GAZ:United States of America 0.407333333 43.92633333 0 2010 3.974 0.005666667 3 0.280333333 10.83133333 0.32 43.86966667 3.415666667 vb 2.829 6.441666667 ENVO:human-associated habitat 624.2906667 0.260666667 12.57966667 0.002666667 0 0.084333333 0 None years 5.338666667 11.16033333 0.526 PMID:21885721 human gut metagenome 1.320333333 0 human 255.657 0 49.409 ENVO:feces 0 7.036333333 0 363.275 13.547 Fisher Brand Commode Specimen Collection System 12.30633333 0.025333333 0 57.788 4700.590333 0.885 38.92033333 65.90333333 23.465 170.3746667 0 314.0536667 1.759333333 1894 40.21066667 0.201333333 0.769333333 2010 1415.095 5.126666667 0.983 2010 0.0 2619.248 14.246 male 1821.119 118.037 0.154 144.5483333 0 2.182333333 52.76366667 1885.791667 4021 1952.433 0.767333333 17.08033333 4/22/10 0.052666667 206.618 2426.106 7890.152333 4.103333333 PMID18248093 UBERON:feces 59.84166667 14.73133333 0.014 15.78666667 ENVO:human-associated habitat 9.740333333 1.343666667 9 105.594 0 2.342333333 15.665 29.974 2.696 0 2.912333333 0.064 CCME 77.75066667 503.0736667 chop 11.163 1.793666667 1.476 1916.854 human gut metagenome 0 2001-01-01 00:00:00 9606 408170 242.6673333 4.181 5.132333333 0.167 0.147333333 1117.359667 3.507333333 GVJ07HB 28.98233333 84.54233333 Titanium 173.7576667 27.226 1.985 3.520666667 0 0.118666667 6.441666667 3.004333333 256.249 0.318 5.857666667 1133.422 7.083333333 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.30566667 1, tablespoon pyrosequencing 0.655666667 2.555333333 24.26566667 4.774666667 154.3783333 9.585333333 V2 CCME 0 0.033666667 3.708 338.2596667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3049.01.S1.405205 ATGCATGC CTGCTGCCTYCCGTA n 58.875 0.066333333 24.0 98.08233333 280.6963333 0.004666667 1478.223333 8.102333333 0.015333333 0.007333333 42.004 UBERON:feces 16S rRNA 0.503666667 23.27 2011 U Penn 473.9076667 0.293666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.085666667 38.73066667 76.74966667 3049 0.016333333 8774.112333 1043.51 1 2009 2.652333333 5.85 -75.2 6.658666667 113 682.2323333 17307.19067 42.84966667 5.455333333 0.104 TCAG 1.081333333 UBERON:feces 0 1.871333333 0.44 0 47.72233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.365333333 0.419 2289.096667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.923 6.433 33.80266667 10.96466667 GAZ:United States of America 0.261333333 17.16966667 1.876333333 2009 4.066 0.005666667 3 0.052666667 15.48166667 0.281666667 14.737 3.691333333 cm 2.859666667 10.945 ENVO:human-associated habitat 3239.185333 0.131333333 12.6 0.002 0 0.34 0.007 None years 4.255666667 6.964666667 1.064 PMID:21885721 human gut metagenome 2.105333333 1.990333333 human 245.0143333 9.266333333 30.36933333 ENVO:feces 0.000333333 13.33766667 0 292.4623333 8.489666667 Fisher Brand Commode Specimen Collection System 10.22866667 0.010666667 5.115666667 33.94633333 9957.035667 1.008666667 117.607 55.79333333 20.30433333 68.71933333 4.464 157.2613333 1.479333333 15455 22.33566667 0.185 2.426 2009 2911.825667 2.358333333 1.786 2010 0.0 2468.048667 16.00533333 female 3311.79 29.34533333 0.075333333 102.2023333 0.000666667 1.924333333 52.47333333 1786.428 3049 3933.353667 1.134 6.458 8/19/10 0.032666667 146.0756667 3310.365333 7474.414333 2.383333333 PMID18248093 UBERON:feces 113.4516667 15.93166667 0.018333333 15.67666667 ENVO:human-associated habitat 12.53866667 5.622666667 24 102.2993333 0 1.916 18.16933333 26.624 2.482333333 0 1.850333333 0.004 CCME 76.799 1496.321667 ctrc 11.401 0.643333333 0.916333333 1873.263333 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 201.9626667 3.829333333 5.342666667 0.121 0.057666667 1032.691333 3.438 GVJ07HB 3.720333333 68.21066667 Titanium 175.4193333 21.50166667 1.406 3.238 0 0.059 10.10066667 2.835333333 450.3366667 0.6 2.919 213.757 2.541666667 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.542 1, tablespoon pyrosequencing 2.679 2.047 14.32966667 7.263666667 122.4973333 16.93933333 V2 CCME 0 0.022666667 3.480333333 596.405 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4018.01.P1.405196 GCGCATAT CTGCTGCCTYCCGTA n 0 0.042333333 3.0 30.62233333 61.65466667 0.000333333 860.114 2.839666667 0.031666667 0.007 10.05566667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 162.3053333 0.381 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.934333333 20.36733333 29.75966667 4018 0.012333333 275.5976667 520.7053333 1 2009 0.737333333 3.616333333 -75.2 3.552 103 507.7056667 2162.358333 17.29266667 3.382333333 0.099666667 TCAG 0.165 UBERON:feces 0 0.675 0.571 0.000333333 62.16133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.350666667 0.215 30.46066667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 12.28733333 1.878666667 7.220666667 5.178 GAZ:United States of America 0.150666667 13.23066667 0 2010 2.185333333 0.007 3 0.088333333 9.746333333 0.243 9.359666667 1.953 vb 1.371333333 4.255 ENVO:human-associated habitat 440.6256667 0.077333333 6.997333333 0.004333333 0 0.115 0.003333333 None years 2.723666667 7.214333333 1.207333333 PMID:21885721 human gut metagenome 0.027 0 human 176.8963333 0.016666667 27.98833333 ENVO:feces 0 4.858666667 0 158.8196667 5.226 Fisher Brand Commode Specimen Collection System 8.675333333 0.007666667 0 25.93266667 305.708 0.485 32.38133333 32.73266667 10.50733333 74.29266667 0.01 66.35566667 0.828666667 3984 12.861 0.112666667 0.827 2010 650.1463333 3.849666667 0.018666667 2010 0.0 1936.222667 12.92333333 female 903.2436667 34.503 0.076666667 103.632 0.004 1.098333333 60.34566667 1153.227333 4018 1206.027333 0.011666667 3.471 4/27/10 0.016333333 148.1096667 1654.774333 4825.103 0.674 PMID18248093 UBERON:feces 86.34033333 9.078 0.000333333 1.039333333 ENVO:human-associated habitat 8.891666667 1.440666667 3 53.118 0 1.195666667 11.24066667 24.78466667 1.611666667 0 1.758666667 0.018666667 CCME 43.22066667 351.2436667 chop 8.370333333 0.711 0.489666667 546.181 human gut metagenome 0 2007-01-01 00:00:00 9606 408170 166.674 2.061 3.533 0.088333333 0.058333333 853.04 1.852 GFIBTIE 22.92566667 88.841 Titanium 72.46333333 11.421 0.711666667 1.739666667 0 0.035333333 4.255 1.443666667 167.255 0.195 2.144333333 495.2293333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.95466667 1, tablespoon pyrosequencing 0.756666667 1.197333333 9.449 7.300666667 203.2536667 6.327 V2 CCME 0 0.014 2.106666667 365.559 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3028.01.S1.405167 ACTCAGTG CTGCTGCCTYCCGTA n 0 0.003666667 27.0 205.503 379.5863333 0 824.3413333 13.57366667 0.016 0.001333333 37.98666667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 441.7843333 0.021666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.951666667 32.658 1468.491 3028 0 4114.205 434.837 1 2009 1.171 3.566333333 -75.2 3.360666667 113 893.1443333 8655.157 54.718 6.042333333 0.216333333 TCAG 0.247333333 UBERON:feces 0 1.541 0.52 0.000666667 55.88266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.003 0.010333333 677.7286667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 23.16433333 5.843 24.41033333 11.25633333 GAZ:United States of America 0.006333333 25.12066667 0 2009 2.181666667 0 0 0.228333333 19.23666667 0.588666667 16.68766667 2.584333333 cm 1.419666667 14.65166667 ENVO:human-associated habitat 3767.343 0.005333333 9.356333333 0.001 0 0.111333333 0 None years 1.625 4.729666667 1.715 PMID:21885721 human gut metagenome 0.029 0 human 310.5623333 0 19.223 ENVO:feces 0 16.203 0 170.86 8.817 Fisher Brand Commode Specimen Collection System 16.686 0.006 0 0.246666667 5187.396 0.569666667 150.582 74.65233333 37.94966667 64.39666667 0 1.039666667 0.790333333 14050 11.52966667 0.190666667 2.351666667 2009 2785.846667 0.008333333 0.313333333 2010 0.0 2293.118333 16.49933333 female 3230.718667 2.322666667 0.255 153.3596667 0 1.133333333 58.78666667 2053.404 3028 4820.086667 0.002 0 4/19/10 0.084333333 219.1526667 2966.344333 8591.442333 1.640666667 PMID18248093 UBERON:feces 198.438 14.27666667 0 221.0133333 ENVO:human-associated habitat 18.03033333 5.787333333 27 131.9166667 0 2.118333333 16.76533333 31.44633333 1.187 0 1.858 0 CCME 54.97 1521.019667 ctrc 6.816 0.767666667 1.11 867.1203333 human gut metagenome 0 1983-01-01 00:00:00 9606 408170 272.5756667 2.152333333 4.554666667 0.005 0.000333333 430.803 1.834666667 GVJ07HB 1.612666667 79.857 Titanium 509.301 39.331 0.068666667 1.993333333 0 0.002 14.65166667 1.965666667 350.819 1.010333333 1.860333333 2.554 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 9.712666667 1, tablespoon pyrosequencing 1.171 1.580333333 11.364 8.081666667 265.3383333 21.84466667 V2 CCME 0 0.009666667 2.364666667 707.1226667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3020.01.P1.405154 AGTGACTC CTGCTGCCTYCCGTA n 0 0.112333333 26.0 104.0926667 305.9563333 0.000333333 1152.284333 6.672333333 0.071 0.015333333 28.397 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 209.0156667 0.921 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.728 27.07333333 223.3693333 3020 0.003 2825.007 652.006 1 2009 1.725666667 3.927333333 -75.2 4.732333333 113 309.2553333 6787.857 34.32766667 4.123 0.570666667 TCAG 0.626 UBERON:feces 0 1.799333333 0.725 0 57.61266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.334666667 0.760666667 769.5346667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 15.07533333 5.316 21.26733333 11.90166667 GAZ:United States of America 0.499666667 16.846 0 2009 2.624666667 0 1 0.413666667 19.686 0.455333333 12.186 2.563333333 cm 1.709333333 14.33 ENVO:human-associated habitat 1841.371 0.318666667 9.312 0.035333333 0 0.513 0 None years 2.361333333 12.771 0.783666667 PMID:21885721 human gut metagenome 0.094666667 0 human 193.9123333 12.84933333 45.08033333 ENVO:feces 0 15.89266667 0 173.6786667 14.18266667 Fisher Brand Commode Specimen Collection System 18.38066667 0.011 0 21.168 3321.459 0.72 107.5903333 91.83633333 35.83 81.637 4.765333333 102.7876667 0.920333333 13441 32.362 0.293 1.396666667 2009 1972.276 1.743 0.134333333 2010 0.0 1795.627 13.18466667 female 2330.595 44.888 0.546 95.136 0.053333333 1.260666667 40.69533333 1838.665667 3020 14989.246 0.266333333 0 3/18/10 0.088333333 136 2359.609 7692.976667 2.367333333 PMID18248093 UBERON:feces 71.796 12.415 0.006 80.13633333 ENVO:human-associated habitat 17.92166667 4.405333333 26 80.48733333 0 1.504666667 14.515 42.93933333 1.837666667 0 1.457333333 0.001666667 CCME 55.49433333 1005.952667 ctrc 8.338333333 1.123 3.114 928.7943333 human gut metagenome 0 1984-01-01 00:00:00 9606 408170 165.5153333 2.807 4.229 0.260666667 0.015333333 897.3563333 2.181333333 GFIBTIE 4.644 82.359 Titanium 272.423 39.714 2.604 1.999 0 0.096666667 14.33 1.876 351.2066667 0.898333333 5.951 375.218 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 11.57933333 1, tablespoon pyrosequencing 1.729333333 1.505333333 26.953 9.224666667 58.936 21.366 V2 CCME 0 0.010666667 2.440333333 267.9516667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3008.01.P1.405178 AGCATCGT CTGCTGCCTYCCGTA n 257.1236667 0.059666667 46.0 48.66666667 626.048 0.047666667 983.0706667 6.137 0.017333333 0.009666667 19.083 UBERON:feces 16S rRNA 1.011 23.27 2011 U Penn 295.1636667 1.926666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.843666667 36.68833333 15.19066667 3008 0.109666667 10143.27633 1137.663 1 2009 1.124333333 5.233666667 -75.2 6.464333333 114 320.2746667 18085.64267 24.25266667 3.934 0.078333333 TCAG 0.359333333 UBERON:feces 0 1.328333333 0.58 0 62.43733333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.397666667 0.399666667 283.8423333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 22.525 3.340666667 12.57833333 5.849333333 GAZ:United States of America 0.564333333 17.668 0 2009 3.476666667 0.018333333 2 0.030333333 8.137666667 0.013 14.64033333 3.051 cm 2.689666667 9.315333333 ENVO:human-associated habitat 14551.03767 0.222 10.97166667 0.01 0 0.112666667 0.001333333 None years 4.858 11.47033333 0.590333333 PMID:21885721 human gut metagenome 5.937333333 7.962 human 154.8653333 0.105666667 41.91266667 ENVO:feces 0.003666667 9.999666667 0 211.29 6.577333333 Fisher Brand Commode Specimen Collection System 10.172 0.044666667 0 43.07133333 10292.79267 0.85 524.738 40.54633333 12.592 81.408 0.059 174.2213333 1.507333333 8460 24.41233333 0.165 1.291666667 2009 3673.358667 3.219 3.902333333 2010 0.0 2408.351667 10.45633333 female 3945.053667 55.69766667 0.070666667 85.25466667 0.000666667 1.853666667 47.14633333 1188.218667 3008 9473.943667 1.822333333 13.62566667 1/18/10 0.016333333 121.858 2388.042333 4971.508 2.018 PMID18248093 UBERON:feces 41.60233333 12.179 0.016 223.083 ENVO:human-associated habitat 6.706 2.516 46 85.73733333 0 0.894 16.28233333 30.53566667 2.428666667 0 1.934 0.006333333 CCME 67.32566667 671.6873333 ctrc 6.404333333 0.826 0.457333333 1995.396 human gut metagenome 0 1964-01-01 00:00:00 9606 408170 133.459 4.17 3.617 0.266333333 0.086333333 882.782 3.182 GFIBTIE 5.056333333 89.25066667 Titanium 149.154 13.354 1.761666667 3.315666667 0 0.049666667 9.315333333 2.813666667 331.3436667 0.217 3.483 279.931 795.171 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 22.138 1, tablespoon pyrosequencing 1.303333333 1.854333333 15.54633333 6.257333333 14.758 13.86766667 V2 CCME 0 0.027333333 3.031 309.9216667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3014.01.P1.405190 AGCTGTAC CTGCTGCCTYCCGTA n 0 0.101 39.0 3.411 63.401 0.012 1132.617667 2.554666667 0.093333333 0.025666667 10.29066667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 100.948 0.180666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.343 43.95133333 27.67166667 3014 0.054 1170.462 435.12 1 2009 1.968 7.066333333 -75.2 7.856 108 275.416 3412.956667 23.813 4.406666667 0.461666667 TCAG 0.046 UBERON:feces 0 0.992333333 3.247 0 66.928 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.802 0.211666667 457.3786667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 27.61366667 3.049666667 7.735 8.755666667 GAZ:United States of America 0.134 7.375666667 0 2009 4.634666667 0.029666667 3 0.074333333 13.63166667 0.001666667 7.422333333 3.824333333 cm 3.604333333 5.347 ENVO:human-associated habitat 296.6343333 0.097 16.12533333 0.008333333 0 0.041666667 0 None years 6.877333333 10.691 0.728666667 PMID:21885721 human gut metagenome 0.052666667 0 human 145.0376667 0 6.427 ENVO:feces 0 6.285666667 0 288.4293333 11.35966667 Fisher Brand Commode Specimen Collection System 17.776 0.024 0 75.363 1412.987333 0.98 41.87633333 71.63033333 30.47 33.90633333 0 290.6663333 2.316 14411 34.27933333 0.375666667 0.732333333 2009 1921.06 3.374666667 0.15 2010 0.0 3626.484333 11.67266667 male 2235.541667 20.93733333 0.146666667 90.04533333 0 2.659333333 35.74466667 1641.975 3014 1902.446 0.169333333 31.61266667 1/28/10 0.003666667 128.7076667 1504.996 6870.022 3.973333333 PMID18248093 UBERON:feces 95.73133333 16.996 0.000333333 0 ENVO:human-associated habitat 11.177 0.28 39 130.3933333 0 1.255333333 17.51333333 39.05433333 3.189666667 0 1.408666667 0.102333333 CCME 99.17733333 487.2083333 ctrc 11.63933333 3.905333333 1.264666667 552.8686667 human gut metagenome 0 1971-01-01 00:00:00 9606 408170 134.747 5.429333333 5.402333333 0.069666667 0.237666667 779.9546667 4.341 GFIBTIE 8.666333333 95.666 Titanium 261.1306667 32.65666667 0.933333333 4.923666667 0 0.083666667 5.347 4.601 233.882 0.140666667 5.724666667 317.371 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 25.143 1, tablespoon pyrosequencing 2.064 1.613666667 19.55033333 7.418 102.5503333 7.963333333 V2 CCME 0 0.001 3.912 203.4983333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4026.01.S1.405219 GAGTCACT CTGCTGCCTYCCGTA n 1.771 0.064666667 3.0 124.654 137.2636667 0.01 855.7836667 4.174333333 0.051333333 0.010666667 15.29533333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 183.319 0.196333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.996666667 39.703 263.625 4026 0.034666667 1576.561667 341.8533333 1 2009 2.524333333 5.417333333 -75.2 5.782333333 107 543.0166667 3890.396667 31.386 3.399333333 0.209 TCAG 0.157 UBERON:feces 0 1.009666667 1.964 0 62.42866667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.629 0.278333333 544.4036667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 26.65566667 2.143333333 11.13366667 26.48266667 GAZ:United States of America 0.177 27.68866667 0 2010 3.405333333 0.018 0 0.215333333 29.85166667 0.019666667 33.963 3.119333333 vb 2.519333333 9.045333333 ENVO:human-associated habitat 1235.402333 0.107 11.63133333 0.002 0 0.099333333 0 None years 4.210333333 8.410666667 1.434 PMID:21885721 human gut metagenome 0.059333333 0.995333333 human 304.868 0.049 47.75433333 ENVO:feces 0 12.028 0 218.42 12.058 Fisher Brand Commode Specimen Collection System 10.24466667 0.024 0 39.71266667 1980.576 0.782666667 83.61533333 81.27066667 24.225 114.0126667 0.016666667 173.2046667 1.556 2485 29.30266667 0.514666667 7.416333333 2010 1391.504333 5.45 0.028 2010 0.0 3790.176333 13.7 male 1879.016333 99.65066667 0.225333333 180.9476667 0.088 1.902666667 54.436 2219.472 4026 7376.244667 0.257333333 14.81433333 4/28/10 0.248333333 258.5776667 1828.347333 9286.271333 2.697 PMID18248093 UBERON:feces 159.8693333 14.962 0.004333333 6.938 ENVO:human-associated habitat 27.03033333 1.742 3 106.0456667 0 1.708666667 15.283 32.88566667 2.277 0 1.402 0.021 CCME 71.09833333 868.4136667 chop 6.804333333 2.528333333 0.727666667 506.901 human gut metagenome 0 2007-01-01 00:00:00 9606 408170 289.2823333 3.724333333 4.730666667 0.086666667 0.111 474.5493333 3.135 GVJ07HB 1.810333333 89.20833333 Titanium 139.7446667 25.36066667 1.068666667 3.312666667 0 0.054 9.045333333 2.937333333 204.496 0.653 5.716666667 176.8053333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.562 1, tablespoon pyrosequencing 2.587 2.644 20.438 12.03966667 211.444 13.489 V2 CCME 0 0.004333333 2.986333333 394.763 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4025.01.S1.405204 GCTACGAT CTGCTGCCTYCCGTA n 0 0.123333333 14.0 145.0586667 76.703 0.006333333 823.875 4.276 0.103666667 0.019 9.314333333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 149.2386667 1.965666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.860666667 29.98833333 103.9176667 4025 0.034333333 501.9846667 327.522 None 2009 1.025333333 4.502666667 -75.2 4.807666667 111 433.579 1926.523 19.92866667 3.413333333 0.211 TCAG 0.043666667 UBERON:feces 0 0.824 2.296333333 0 58.83633333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.315666667 0.564333333 87.33566667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 17.67933333 2.072 5.005 9.719666667 GAZ:United States of America 0.599333333 36.18233333 0 2010 3.039 0.006 6 0.033333333 13.27933333 0.038 34.14766667 2.688 emd 2.259 5.922333333 ENVO:human-associated habitat 526.7593333 0.326 9.632666667 0.002 0 0.161 0.000333333 None years 3.504333333 12.45866667 0.483 PMID:21885721 human gut metagenome 0.045666667 0 human 265.153 0 54.53466667 ENVO:feces 0 7.027 0 287.3436667 13.31033333 Fisher Brand Commode Specimen Collection System 10.41233333 0.065666667 0 39.28633333 597.611 0.738333333 30.67566667 68.56966667 21.12933333 131.587 0 395.9106667 1.331 2016 45.96266667 0.459666667 1.515333333 2010 1584.278667 2.171666667 0.044 2010 0.0 3665.937333 9.428 female 1934.011 126.7156667 0.080333333 158.33 0 1.601 55.36966667 1911.907667 4025 2352.240667 0.037666667 9.405333333 4/7/10 0.132 226.2453333 1453.287667 7999.422 2.599333333 PMID18248093 UBERON:feces 115.812 12.543 0.002 10.511 ENVO:human-associated habitat 11.92433333 1.026333333 14 110.924 0 1.530333333 14.62666667 32.22366667 2.043666667 0 1.522333333 0.012 CCME 59.21533333 249.0013333 chop 5.451333333 2.845 1.049666667 377.323 human gut metagenome 0 1996-01-01 00:00:00 9606 408170 255.58 2.928666667 4.361666667 0.451333333 0.176 521.3746667 2.739333333 GVJ07HB 3.961333333 84.07866667 Titanium 139.9713333 22.52366667 2.389333333 2.671333333 0 0.104333333 5.922333333 2.424 141.9723333 0.295 5.851333333 277.721 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.387 1, tablespoon pyrosequencing 1.071666667 0.944 25.90766667 5.982666667 167.1076667 8.816 V2 CCME 0 0.003333333 2.739666667 316.3463333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3017.01.P1.405175 AGTCGTCA CTGCTGCCTYCCGTA n 0 0.172333333 32.0 72.55033333 229.408 0.008 1294.174 7.531 0.014666667 0.032 21.02666667 UBERON:feces 16S rRNA 0.268 23.27 2011 U Penn 275.5183333 0.455 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.281333333 52.02466667 16.118 3017 0.024333333 756.0643333 173.8326667 1 2009 2.629 7.012 -75.2 8.631666667 108 570.1063333 1662.797 41.75 5.859666667 0.487 TCAG 0.065666667 UBERON:feces 0 1.955 1.66 0 57.12666667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.886333333 0.367 34.179 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 34.287 3.609 13.06833333 20.75033333 GAZ:United States of America 0.292333333 17.65066667 0 2009 4.579666667 0.016 0 0.398666667 26.99833333 0.042 20.39933333 4.124333333 cm 3.452 9.664 ENVO:human-associated habitat 877.5943333 0.159333333 16.29466667 0.021 0 0.169 0 None years 6.135666667 10.38233333 1.066666667 PMID:21885721 human gut metagenome 2.586333333 0 human 276.9363333 16.58233333 15.89666667 ENVO:feces 0 11.96933333 0 364.5773333 17.51266667 Fisher Brand Commode Specimen Collection System 13.69566667 0.045333333 0 56.72766667 781.213 1.064333333 142.715 105.2466667 38.53733333 59.57366667 4.812 182.9636667 2.085333333 14145 39.98 0.381333333 5.136333333 2009 4200.296 2.117333333 2.061 2010 0.0 4691.362333 15.77466667 male 4661.453667 48.39933333 0.261333333 146.7563333 0 2.719 43.70933333 2541.238667 3017 1257.689333 0.161666667 24.07133333 2/9/10 0.009666667 209.757 2786.368333 10632.54267 3.942 PMID18248093 UBERON:feces 166.0103333 18.882 0.012666667 126.2933333 ENVO:human-associated habitat 24.05866667 2.825666667 32 128.232 0 1.84 24.61933333 35.89366667 3.148666667 0 1.707 0.051 CCME 98.66866667 728.9173333 ctrc 12.33366667 2.191666667 1.629666667 238.9336667 human gut metagenome 0 1978-06-01 00:00:00 9606 408170 255.8426667 5.765666667 5.86 0.142666667 0.087666667 833.3393333 4.152666667 GFIBTIE 1.516333333 81.65266667 Titanium 218.368 40.98466667 1.946333333 4.501333333 0 0.14 9.664 4.378 398.972 0.446666667 8.408666667 108.7316667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.66433333 1, tablespoon pyrosequencing 2.677333333 2.501333333 30.52666667 9.497 173.2296667 14.397 V2 CCME 0 0.009666667 4.049666667 448.748 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3031.01.S1.405209 ACTGACTG CTGCTGCCTYCCGTA n 0 0.172666667 30.0 67.999 229.983 0.008666667 1054.369 7.756666667 0.234666667 0.024 21.96766667 UBERON:feces 16S rRNA 0.376666667 23.27 2011 U Penn 229.2983333 0.986666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.856333333 25.497 19.89733333 3031 0.013333333 9562.819333 1468.752333 3 2009 1.077666667 3.922666667 -75.2 4.411 113 513.082 18492.892 27.43533333 5.641666667 0.307 TCAG 0.193 UBERON:feces 0 1.092333333 3.988333333 0 62.21033333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.135666667 1.121666667 434.091 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.49866667 4.018 13.90166667 13.50666667 GAZ:United States of America 0.873 13.874 0 2009 2.685666667 0.000666667 4 0.033 9.783 0.474 7.506333333 2.337666667 cm 1.848 5.476333333 ENVO:human-associated habitat 3690.453 0.503333333 8.149666667 0.018333333 0 0.127 0 None years 2.862 12.90533333 0.346 PMID:21885721 human gut metagenome 2.371 0 human 264.61 12.28333333 65.91966667 ENVO:feces 0.001 7.116666667 0 213.8073333 13.45466667 Fisher Brand Commode Specimen Collection System 11.632 0.119666667 0 22.20533333 9789.829 0.66 211.6853333 70.06766667 23.54466667 99.067 4.297666667 212.0886667 1.040333333 12322 39.07066667 0.546333333 1.943 2009 2785.899333 0.972333333 1.895666667 2010 0.0 3054.157667 13.432 female 3166.720667 82.75533333 0.111 150.7096667 0.004 1.255333333 54.084 1923.827667 3031 535.976 0.031 2.428333333 4/26/10 0.074666667 215.4526667 2197.051333 8049.295667 5.416666667 PMID18248093 UBERON:feces 125.401 10.50866667 0.021 255.25 ENVO:human-associated habitat 8.412333333 2.742333333 30 90.87366667 0 1.485333333 19.08533333 31.89966667 1.695 0 1.984666667 0.113 CCME 49.654 670.395 ctrc 6.645 4.674 0.778666667 2284.571 human gut metagenome 0 1980-01-01 00:00:00 9606 408170 242.032 2.503666667 3.505666667 0.4 0.074333333 808.482 2.268333333 GVJ07HB 6.223333333 88.93533333 Titanium 272.921 25.56933333 3.427333333 2.148 0 0.147666667 5.476333333 1.742666667 313.618 0.676 6.421666667 652.9326667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 9.728333333 1, tablespoon pyrosequencing 1.101333333 1.461666667 28.184 4.427 166.8916667 8.139333333 V2 CCME 48.83333333 0.014333333 2.538333333 396.1893333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4009.01.P1.405179 CAGTCAGT CTGCTGCCTYCCGTA n 0 0.125 7.0 42.412 102.043 0.053666667 737.9303333 3.037 0.076333333 0.023666667 11.87466667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 104.5723333 0.497333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.704 28.98833333 16.40666667 4009 0.187 832.1956667 417.9443333 None 2009 2.312666667 4.026333333 -75.2 4.227666667 104 359.4006667 2566.528333 19.203 2.562 0.202 TCAG 0.376666667 UBERON:feces 0 0.994666667 2.522333333 0 58.56033333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.199666667 0.566333333 8.187333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.70566667 1.806 8.823333333 17.239 GAZ:United States of America 0.421 29.4 0 2009 2.668666667 0.023 0 0.104666667 21.81233333 0.223 23.88533333 2.276333333 emd 1.975333333 4.713666667 ENVO:human-associated habitat 814.567 0.286666667 8.785666667 0.015333333 0 0.017666667 0 None years 3.415 11.641 0.922666667 PMID:21885721 human gut metagenome 0.012666667 0 human 208.3883333 0 28.93666667 ENVO:feces 0.002666667 6.590666667 0 165.097 13.04433333 Fisher Brand Commode Specimen Collection System 12.72333333 0.090333333 0 34.43366667 844.4936667 0.617 78.17133333 78.51266667 25.59733333 94.71466667 0 181.5686667 1.193666667 6718 33.761 0.664333333 4.193666667 2009 1327.399 2.913666667 0.034333333 2010 0.0 2569.084333 11.86333333 female 1689.946333 84.122 0.169 115.8696667 0 1.433666667 49.564 1722.259 4009 0.011666667 0.269666667 12.323 3/16/10 0.036333333 165.5783333 1284.327667 7205.931333 5.306333333 PMID18248093 UBERON:feces 92.07733333 10.64033333 0 17.18233333 ENVO:human-associated habitat 19.058 1.206333333 7 94.419 0 1.114666667 13.21466667 37.52133333 1.768666667 0 1.177666667 0.037 CCME 53.63366667 488.9796667 chop 5.260666667 3.390333333 0.902 488.319 human gut metagenome 0 2003-01-01 00:00:00 9606 408170 196.5136667 2.670333333 3.635 0.179666667 0.100666667 532.0503333 2.384 GFIBTIE 7.168 83.683 Titanium 141.326 26.88066667 1.907 2.455333333 0 0.104666667 4.713666667 2.235666667 181.499 0.28 6.618333333 347.57 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.96633333 1, tablespoon pyrosequencing 2.578666667 1.259 24.43833333 10.49166667 149.7733333 7.047333333 V2 CCME 0 0.005666667 2.270333333 254.3453333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3022.01.P1.405216 AGTGCTCA CTGCTGCCTYCCGTA n 0 0.212333333 50.0 88.39366667 96.71266667 0.153333333 1417.088667 4.464333333 0.100666667 0.049666667 17.12633333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 307.655 0.409666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.584 59.26533333 24.33033333 3022 0.158 6840.698667 841.0936667 1 2009 2.977 9.455333333 -75.2 10.67133333 108 595.485 12363.18167 27.37733333 4.730666667 0.41 TCAG 0.215666667 UBERON:feces 0 1.991333333 3.116333333 0 67.468 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.32 0.588 64.54166667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 34.12333333 3.694333333 12.39833333 21.41433333 GAZ:United States of America 0.403 19.94066667 0 2009 6.132666667 0.04 5 0.124666667 27.28133333 0.039333333 24.28 5.270333333 cm 4.897666667 8.343 ENVO:human-associated habitat 2937.658333 0.202333333 21.14866667 0.045333333 0 0.093 0 None years 9.500666667 13.358 0.747666667 PMID:21885721 human gut metagenome 0.246666667 0 human 231.24 0.083333333 58.88266667 ENVO:feces 0 10.73333333 0 431.1453333 21.365 Fisher Brand Commode Specimen Collection System 14.43766667 0.066333333 0 103.2403333 6885.135333 1.508666667 203.132 114.5173333 36.905 109.1406667 0.026333333 511.473 3.086 11305 62.66266667 0.609666667 6.717 2009 2127.817667 5.001666667 0.205333333 2010 0.0 6015.314333 16.27266667 male 2581.344333 74.275 0.15 142.8233333 0 3.571 37.44466667 2475.671667 3022 3403.908 1.561666667 38.90666667 3/18/10 0.162333333 204.1676667 2609.392333 10358.211 4.025666667 PMID18248093 UBERON:feces 94.21133333 22.837 0 0 ENVO:human-associated habitat 23.51466667 2.115333333 50 200.864 0 1.989333333 28.08166667 41.114 4.252333333 0 1.699333333 0.080666667 CCME 130.635 428.73 ctrc 13.692 4.038666667 2.497 1414.855 human gut metagenome 0 1960-01-01 00:00:00 9606 408170 214.1133333 7.621333333 6.992 0.170333333 0.255666667 930.9013333 5.74 GFIBTIE 1.918666667 96.44733333 Titanium 302.2396667 40.19933333 2.544 6.397333333 0 0.172666667 8.343 6.149 329.5563333 0.457 10.14166667 267.332 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 21.44333333 1, tablespoon pyrosequencing 3.328666667 2.255 36.722 9.613 169.1146667 12.43766667 V2 CCME 0 0.010333333 5.102666667 476.7696667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3072.01.S2.405173 CGTAGCAT CTGCTGCCTYCCGTA n 0 0.063666667 34.0 57.23333333 228.1963333 0.022666667 1226.371667 5.015 0.067333333 0.012 19.95533333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 423.8813333 0.196666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.306 43.751 4.121666667 3072 0.109333333 10885.84167 1373.116667 1 2009 0.778666667 6.290333333 -75.2 7.484333333 114 908.7813333 22444.32067 31.73766667 3.823 0.197 TCAG 0.488666667 UBERON:feces 0 1.122 0.918666667 0 58.68066667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.955 0.297 3950.917333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 28.546 3.194333333 14.84633333 4.972666667 GAZ:United States of America 0.191333333 19.15 0 2009 4.085666667 0.017333333 0 0.119333333 6.209 0.99 26.15066667 3.569333333 cm 3.197 8.19 ENVO:human-associated habitat 4156.858 0.14 13.433 0.024666667 0 0.167 0.000666667 None years 5.328666667 7.564666667 0.478333333 PMID:21885721 human gut metagenome 0.07 0 human 233.0606667 6.056333333 31.763 ENVO:feces 0.006 8.801333333 0 284.947 8.165666667 Fisher Brand Commode Specimen Collection System 9.712666667 0.029 0.000666667 50.366 12863.361 0.912333333 175.9306667 43.437 17.67466667 88.24033333 1.842666667 170.0816667 1.844666667 6705 23.308 0.139666667 0.592666667 2009 1817.645667 5.328333333 0.141333333 2010 0.0 2505.746333 19.42566667 female 2171.845333 28.54733333 0.082666667 125.201 0.024 2.327666667 57.25933333 1675.747667 3072 12139.07333 0.222333333 21.688 9/16/10 0.179 178.9 2712.019 7011.329333 3.364333333 PMID18248093 UBERON:feces 112.1096667 16.68033333 0.002 15.93833333 ENVO:human-associated habitat 5.13 3.091333333 34 137.849 0 2.272 14.754 22.45866667 2.750666667 0 2.054333333 0.032333333 CCME 82.33466667 478.387 ctrc 14.00266667 1.116 0.731 2445.063333 human gut metagenome 0 1976-01-01 00:00:00 9606 408170 213.1053333 4.557666667 5.189333333 0.087333333 0.095 756.6126667 3.554 GVJ07HB 7.645 83.84966667 Titanium 158.783 18.94333333 1.159 4.051333333 0 0.053 8.19 3.567666667 256.6773333 0.269 3.761333333 301.1696667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.51 1, tablespoon pyrosequencing 0.934666667 1.868333333 14.65766667 3.244 285.2256667 12.2 V2 CCME 0 0.03 3.632 709.1066667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4028.01.S1.405148 GATCACGT CTGCTGCCTYCCGTA n 0 0.327666667 2.0 67.76466667 79.09066667 0.004333333 1309.228 4.236666667 0.403333333 0.048333333 10.60533333 UBERON:feces 16S rRNA 0.052666667 23.27 2011 U Penn 159.9543333 1.536 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.107666667 34.16866667 76.27533333 4028 0.022 641.1973333 817.4966667 None 2009 1.020333333 5.621 -75.2 5.250333333 105 483.2856667 3674.924333 22.57633333 5.031666667 0.195333333 TCAG 0.078666667 UBERON:feces 0 0.961 3.357333333 0 60.82566667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 7.081333333 1.796666667 18.281 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 19.09266667 2.021333333 6.166 7.450666667 GAZ:United States of America 1.363666667 38.196 0 2010 3.707 0.005 3 0.087666667 8.896333333 0.004333333 29.08333333 3.178 mcb 2.568 3.817 ENVO:human-associated habitat 581.377 0.946333333 11.29433333 0.060333333 0 0.18 0 None years 4.111 16.57766667 0.221666667 PMID:21885721 human gut metagenome 0.423 0 human 310.193 0.147333333 55.60666667 ENVO:feces 0.015333333 4.693 0 281.0456667 20.416 Fisher Brand Commode Specimen Collection System 11.63033333 0.135333333 0 47.25566667 688.4756667 0.904666667 34.36833333 88.63966667 26.533 159.3556667 0.046333333 366.021 1.569333333 0 61.57466667 0.552333333 1.519 2010 1264.168 5.285666667 0.535 2010 0.0 3605.831667 12.34433333 male 1721.196333 143.477 0.089666667 182.9946667 0 1.702666667 53.143 2280.09 4028 5007.15 3.443666667 6.156 5/18/10 0.008333333 261.5326667 1920.616667 9539.896 9.969666667 PMID18248093 UBERON:feces 129.019 15.37666667 0 6.235333333 ENVO:human-associated habitat 7.531 1.034 2 112.3623333 0 1.893333333 17.26633333 34.31333333 2.563333333 0 2.465666667 0.261666667 CCME 69.86033333 397.1903333 chop 9.364666667 4.135666667 1.732 874.8696667 human gut metagenome 0 2008-01-01 00:00:00 9606 408170 299.5876667 2.939 5.773333333 0.610333333 0.084666667 1128.749667 3.249 GVJ07HB 26.31966667 86.931 Titanium 195.8976667 30.07833333 5.350333333 2.725333333 0 0.28 3.817 2.155 212.0756667 0.288333333 9.772666667 760.1236667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.48533333 1, tablespoon pyrosequencing 1.067 1.059666667 42.84533333 3.481666667 190.1416667 5.682 V2 CCME 0 0.002333333 3.278666667 350.096 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3077.01.S1.405161 CTAGTCGA CTGCTGCCTYCCGTA n 0 0.078666667 24.0 67.40233333 157.2966667 0.007333333 693.5366667 2.364333333 0.040333333 0.013333333 9.818333333 UBERON:feces 16S rRNA 0.127333333 23.27 2011 U Penn 166.3383333 0.26 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.789 25.09566667 20.02733333 3077 0.029 4811.567667 578.1456667 1 2009 0.632666667 4.093666667 -75.2 4.681666667 107 299.1333333 9327.020667 16.324 3.351 0.072333333 TCAG 0.105333333 UBERON:feces 0 0.664 0.596666667 0 65.28 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.042333333 0.349666667 1013.251667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 15.19266667 3.293 7.42 2.959666667 GAZ:United States of America 0.24 26.29233333 0 2009 2.831666667 0.013333333 4 0.028666667 5.811333333 0.020666667 23.08 2.367666667 cm 2.084666667 4.129666667 ENVO:human-associated habitat 3444.615 0.171666667 8.506 0.007333333 0 0.296666667 0.000333333 None years 3.654 7.645 0.809 PMID:21885721 human gut metagenome 0.694666667 0 human 184.6483333 0 23.71133333 ENVO:feces 0 4.493666667 0 193.5213333 6.626333333 Fisher Brand Commode Specimen Collection System 10.30366667 0.034666667 1.241333333 36.19133333 5328.207 0.594333333 191.626 34.95933333 13.29733333 79.20733333 0 198.651 1.279 5450 21.879 0.111 0.484666667 2009 1533.399 1.416666667 0.441333333 2010 0.0 3273.721667 8.598 male 1791.724667 64.65066667 0.057666667 115.2253333 0.047666667 1.473333333 57.52133333 1248.399 3077 1178.518 0.836333333 11.32733333 9/28/10 0.093666667 164.6986667 1520.535667 5223.301333 0.799333333 PMID18248093 UBERON:feces 81.917 9.618333333 0.024666667 63.627 ENVO:human-associated habitat 4.972666667 1.660666667 24 74.931 0 0.827666667 12.31866667 23.81033333 1.816666667 0 0.951333333 0.016666667 CCME 52.62233333 277.25 ctrc 6.186 0.777666667 0.781333333 1022.163 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 174.8296667 3.066 3.017333333 0.115 0.110333333 429.6183333 2.557 GVJ07HB 5.027666667 93.32066667 Titanium 207.917 14.335 1.143666667 2.652666667 0 0.065333333 4.129666667 2.313666667 163.4196667 0.16 2.51 134.1283333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.63533333 1, tablespoon pyrosequencing 0.682333333 1.23 11.82833333 3.841666667 78.13566667 6.158666667 V2 CCME 0 0.02 2.368333333 244.4736667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3025.01.P1.405184 CAGTCTGA CTGCTGCCTYCCGTA n 217.3923333 0.063 38.0 218.612 218.7543333 0.074666667 1866.639667 7.776666667 0.005666667 0.007333333 37.88366667 UBERON:feces 16S rRNA 3.175666667 23.27 2011 U Penn 396.74 1.451333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.793666667 64.69433333 51.35 3025 0.093333333 12351.33033 1708.928667 1 2009 0.808333333 8.468333333 -75.2 9.397666667 114 1589.347 24579.94 50.12566667 18.25233333 0.095666667 TCAG 1.057 UBERON:feces 0 2.47 1.401 0.004333333 59.623 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 8.723666667 0.413333333 2437.671 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 42.59266667 6.709 30.106 8.216 GAZ:United States of America 0.335666667 12.43866667 38.78933333 2009 5.620666667 0.025 1 0.046 11.258 0.018666667 18.08966667 4.919333333 cm 3.907 30.29033333 ENVO:human-associated habitat 3253.968333 0.175666667 17.38033333 0.009333333 0 0.438333333 0.002333333 None years 6.544 9.495 0.61 PMID:21885721 human gut metagenome 21.94033333 13.204 human 272.3373333 0.056333333 47.77233333 ENVO:feces 0 52.636 0 302.1833333 12.22833333 Fisher Brand Commode Specimen Collection System 8.690666667 0.020333333 0.005333333 55.034 13595.841 1.326 141.1253333 55.12533333 18.076 100.712 0.022 101.4133333 2.191 4228 25.93533333 0.324333333 1.723333333 2009 2630.743333 13.30433333 15.60266667 2010 0.0 3756.626667 36.949 female 3095.145 41.473 0.053 137.3413333 0.047333333 2.664 53.99966667 1916.583 3025 729.6266667 0.382666667 10.251 3/18/10 0.243 196.277 3883.414 8018.984333 1.682333333 PMID18248093 UBERON:feces 119.4993333 20.545 0.167 113.9216667 ENVO:human-associated habitat 10.13833333 3.352333333 38 137.5713333 0 3.373 23.09333333 25.24866667 3.857333333 0 5.019 0.001 CCME 105.524 1500.491667 ctrc 30.346 1.815333333 0.665 2841.915 human gut metagenome 0 1972-01-01 00:00:00 9606 408170 232.031 5.596333333 7.017 0.213 0.075333333 1633.294667 4.903 GFIBTIE 20.29 85.20866667 Titanium 187.6433333 19.01066667 1.886 4.858 0 0.055333333 12.83533333 3.830333333 479.866 0.432333333 3.489666667 575.9416667 2741.049 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 20.90433333 1, tablespoon pyrosequencing 1.001 4.904 20.658 5.163333333 701.4716667 57.91733333 V2 CCME 0 0.039 5.108333333 1098.211333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4005.01.P1.405155 ATCGTACG CTGCTGCCTYCCGTA n 0 0.145666667 11.0 40.80066667 84.34666667 0.017333333 995.7706667 2.818 0.102 0.02 8.189666667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 106.5933333 0.509 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.836666667 27.22366667 67.87433333 4005 0.054 1972.115667 660.6736667 None 2009 1.517 4.418 -75.2 4.676 111 320.6093333 5483.729333 16.10866667 3.165 0.301666667 TCAG 0.155 UBERON:feces 0 0.639 1.817666667 0 66.36433333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.415333333 0.762333333 716.2583333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 15.03666667 1.403333333 5.319 10.58 GAZ:United States of America 0.493666667 41.90933333 0 2009 3 0.018666667 0 0.085 16.409 0.026333333 32.284 2.574 erin 2.266 4.260333333 ENVO:human-associated habitat 411.5786667 0.374666667 9.377666667 0.004666667 0 0.355 0 None years 3.663 11.84733333 0.628666667 PMID:21885721 human gut metagenome 0.045666667 0 human 229.1146667 0 40.56066667 ENVO:feces 0.008 5.441 0 227.086 13.756 Fisher Brand Commode Specimen Collection System 10.324 0.044333333 0 42.06033333 2364.183333 0.731333333 61.23833333 69.52733333 19.99833333 124.525 0 313.9003333 1.321666667 7005 40.58566667 0.302 3.161 2009 954.3903333 2.773333333 0.065666667 2010 0.0 3417.428667 10.38866667 female 1304.339 105.839 0.103 147.278 0.022 1.546333333 54.598 1753.781333 4005 4655.922667 0.054 8.159666667 3/18/10 0.087666667 210.4706667 1432.605667 7337.819667 3.781 PMID18248093 UBERON:feces 93.77266667 11.70233333 0.004 0.833333333 ENVO:human-associated habitat 14.44433333 0.689333333 11 84.594 0 1.204333333 14.79733333 32.955 1.963666667 0 1.588333333 0.033333333 CCME 58.162 190.56 chop 6.097333333 2.229 1.403666667 857.689 human gut metagenome 0 1999-01-01 00:00:00 9606 408170 220.925 2.844666667 4.389666667 0.225 0.175 712.695 2.707 GFIBTIE 5.634333333 94.84 Titanium 118.905 21.917 2.319 2.652 0 0.125333333 4.260333333 2.641 139.83 0.228666667 5.588666667 463.6583333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.482 1, tablespoon pyrosequencing 1.614666667 1.201 24.64366667 7.627333333 125.8056667 6.363 V2 CCME 0 0.004333333 2.606666667 232.399 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3048.01.S1.405162 ATCGTACG CTGCTGCCTYCCGTA n 0 0.071666667 38.0 21.40033333 82.46166667 0.013 930.5216667 1.861 0.018666667 0.017333333 7.052 UBERON:feces 16S rRNA 0.031666667 23.27 2011 U Penn 147.9666667 0.184 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.107333333 44.45366667 24.25466667 3048 0.039333333 852.147 324.942 1 2009 1.062666667 6.209333333 -75.2 7.076666667 114 329.0063333 2296.386 13.89533333 3.052333333 0.265 TCAG 0.077666667 UBERON:feces 0 0.778333333 0.509 0.000333333 52.17566667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.898 0.297 19.58166667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 27.854 2.272 5.185 6.979333333 GAZ:United States of America 0.191333333 11.42133333 0 2009 4.125666667 0.025333333 4 0.04 10.25766667 0.052333333 8.832 3.402666667 cm 3.298333333 3.348333333 ENVO:human-associated habitat 1042.028 0.114 13.38766667 0.004 0 0.057 0 None years 6.366666667 11.08933333 0.579666667 PMID:21885721 human gut metagenome 0.341 0 human 112.22 21.948 14.61433333 ENVO:feces 0 4.115 0 310.5866667 10.709 Fisher Brand Commode Specimen Collection System 12.14866667 0.006 0 69.02166667 874.1556667 0.996 73.665 54.698 19.143 39.953 7.403 244.251 2.041 15502 30.47833333 0.127666667 1.746666667 2009 3771.432667 1.892666667 0.155666667 2010 0.0 2174.403333 9.611333333 female 4057.199333 30.231 0.042 58.455 0.118666667 2.615333333 33.83766667 1424.499 3048 1583.005667 0.021333333 29.88266667 7/15/10 0.014666667 83.536 1666.661667 5960.104667 2.529333333 PMID18248093 UBERON:feces 49.477 14.78533333 0 78.93333333 ENVO:human-associated habitat 8.842666667 1.153 38 98.583 0 1.093333333 12.279 33.18366667 2.792666667 0 1.193666667 0.01 CCME 82.916 220.7166667 ctrc 7.953666667 0.673 1.075333333 397.7883333 human gut metagenome 0 1972-01-01 00:00:00 9606 408170 105.1686667 4.576 4.54 0.096333333 0.191666667 662.163 3.916333333 GVJ07HB 2.499 74.563 Titanium 109.371 20.63533333 1.192666667 4.171666667 0 0.054666667 3.348333333 3.656 234.499 0.128333333 4.904 252.0956667 1604.508667 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 25.73133333 1, tablespoon pyrosequencing 1.141 1.785 18.08466667 6.372666667 106.5213333 4.995666667 V2 CCME 0 0.013666667 3.216 254.4883333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3047.01.S1.405194 ATCGATGC CTGCTGCCTYCCGTA n 31.671 0.069 25.0 43.34433333 130.261 0.002333333 1115.996333 4.045666667 0.085 0.009333333 18.33033333 UBERON:feces 16S rRNA 0.146 23.27 2011 U Penn 136.147 2.684333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.097 38.503 22.87666667 3047 0.028333333 711.6973333 480.0036667 1 2009 1.462333333 4.81 -75.2 4.688666667 113 1117.629333 2672.843333 27.00766667 3.550333333 0.08 TCAG 0.33 UBERON:feces 0 1.345666667 1.095333333 0 62.08333333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.150666667 0.433666667 97.51266667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 26.10666667 4.140666667 14.191 14.67766667 GAZ:United States of America 0.582 36.72633333 0 2009 3.091333333 0.007 2 0.076333333 16.896 0.025 35.00233333 2.794666667 cm 2.123666667 7.459 ENVO:human-associated habitat 914.2246667 0.257333333 9.796333333 0.043 0 0.136 0.000333333 None years 3.333333333 8.267666667 0.818666667 PMID:21885721 human gut metagenome 0.888666667 31.671 human 359.6943333 0.031 78.67933333 ENVO:feces 0 9.272333333 0 283.014 8.982333333 Fisher Brand Commode Specimen Collection System 6.353333333 0.016333333 0 32.161 771.892 0.743666667 44.17366667 57.10566667 14.52966667 167.1563333 0.009666667 295.5186667 1.305333333 13238 35.131 0.254666667 3.679 2009 2650.094333 5.348333333 0.545333333 2010 0.0 3158.275333 44.80866667 female 3142.137333 151.5396667 0.095666667 212.4196667 0 1.541333333 65.61933333 2140.051333 3047 28787.98033 0.069 7.259666667 7/12/10 0.061333333 303.5476667 1913.945 8953.974667 4.7 PMID18248093 UBERON:feces 164.4936667 14.342 0.007 57.09733333 ENVO:human-associated habitat 15.23833333 1.235666667 25 96.13066667 0 2.155 15.068 23.29733333 2.042333333 0 2.731 0.05 CCME 60.57233333 1110.415333 ctrc 13.88 1.424 0.589 544.328 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 340.9726667 2.916 4.814666667 0.497 0.131333333 762.437 2.681333333 GVJ07HB 11.912 88.71766667 Titanium 384.7436667 15.43766667 2.110666667 2.692333333 0 0.058666667 7.459 2.256333333 300.1136667 0.771333333 4.013333333 415.6793333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 11.10466667 1, tablespoon pyrosequencing 1.499666667 2.240333333 20.15366667 6.797666667 577.518 11.13 V2 CCME 0 0.008333333 3.015333333 713.6653333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4006.01.P1.405141 ATGCATGC CTGCTGCCTYCCGTA n 0 0.215666667 21.0 102.883 523.6243333 0.095666667 1380.087333 4.535 0.061666667 0.031 17.045 UBERON:feces 16S rRNA 0.522333333 23.27 2011 U Penn 282.0533333 0.994333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.010666667 39.02666667 1889.226667 4006 0.109666667 8844.679333 1451.684 1 2009 1.934 7.200666667 -75.2 7.304666667 113 478.845 19634.10367 28.49566667 4.896 0.193333333 TCAG 0.249666667 UBERON:feces 0 1.492666667 3.319 0 58.96166667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.794333333 1.342 1727.265333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.16566667 3.388 12.33333333 16.441 GAZ:United States of America 1.150333333 22.12566667 12.09233333 2009 4.766 0.025 4 0.284 17.548 0.020666667 15.98333333 4.091 dhc 3.294666667 14.075 ENVO:human-associated habitat 7814.750667 0.643 14.48766667 0.029333333 0 0.264 0.005 None years 6.344666667 14.42733333 0.602333333 PMID:21885721 human gut metagenome 3.306 0 human 196.5633333 23.72233333 28.46733333 ENVO:feces 0 22.58233333 0 266.8366667 17.03133333 Fisher Brand Commode Specimen Collection System 12.061 0.051333333 0.100333333 60.834 10652.92533 1.071666667 326.2943333 87.55266667 26.853 77.36633333 8.238666667 208.018 1.998333333 3367 45.50033333 0.616666667 4.124 2009 3953.752 3.621666667 2.273 2010 0.0 3518.207333 11.14166667 female 4368.554 46.15233333 0.208333333 105.8263333 0.096 2.600333333 37.73566667 2051.565667 4006 383.1763333 0.274 12.68333333 3/4/10 0.007333333 151.2763333 2553.720333 8583.750333 2.181666667 PMID18248093 UBERON:feces 82.355 18.24966667 0.021666667 99.25666667 ENVO:human-associated habitat 15.29066667 2.428333333 21 116.001 0 1.174666667 20.82033333 36.739 3.507 0 1.851666667 0.026 CCME 89.34766667 590.9743333 chop 9.58 4.062666667 1.321 2339.427667 human gut metagenome 0 1989-01-01 00:00:00 9606 408170 179.5183333 4.615666667 6.985333333 0.485 0.055666667 1155.999667 4.036333333 GFIBTIE 8.343333333 84.284 Titanium 261.567 28.82033333 4.054666667 3.660333333 0 0.184333333 8.633333333 3.066666667 371.184 0.428 7.665666667 563.94 265.057 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.37766667 1, tablespoon pyrosequencing 2.164666667 1.892333333 34.752 7.519333333 115.727 24.96866667 V2 CCME 0 0.021333333 4.185666667 397.7803333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3001.01.P1.405185 ACTGTCAG CTGCTGCCTYCCGTA n 161.9713333 0.469333333 26.0 43.543 220.1473333 0.015666667 1806.521667 8.345333333 0.109 0.069333333 21.52033333 UBERON:feces 16S rRNA 0.039 23.27 2011 U Penn 275.5743333 0.816 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.946 65.36633333 316.2833333 3001 0.055 4018.967667 903.3273333 1 2009 2.826666667 9.201666667 -75.2 9.661333333 107 1037.265333 9579.487667 50.136 7.112666667 0.358666667 TCAG 0.376 UBERON:feces 0 1.78 2.892 0.001333333 61.91233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.906666667 0.900333333 1102.294333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 41.10233333 5.093666667 12.68733333 18.39933333 GAZ:United States of America 0.701 18.47533333 0 2009 5.987 0.020666667 6 0.108333333 26.036 0.146333333 10.90366667 5.431666667 cm 4.546333333 10.428 ENVO:human-associated habitat 975.249 0.429666667 20.299 0.032333333 0 0.324 0.004666667 None years 7.342 10.81266667 0.665666667 PMID:21885721 human gut metagenome 0.299 0 human 349.841 58.829 60.08666667 ENVO:feces 0 12.61533333 0 469.9053333 21.33733333 Fisher Brand Commode Specimen Collection System 11.56633333 0.192666667 0.101 73.53333333 4728.256667 1.456 91.18133333 120.8933333 42.87866667 103.299 9.885666667 464.543 2.724 5235 63.268 0.483666667 4.325 2009 3612.208667 5.626666667 0.507333333 2009 0.0 6061.761333 28.30233333 male 4234.258 71.86033333 0.218 197.6433333 0.000333333 3.277 42.83366667 3368.258667 3001 13654.02567 1.135666667 26.13466667 12/14/09 0.288333333 282.4333333 3504.739333 14092.79533 3.609666667 PMID18248093 UBERON:feces 195.8216667 26.24033333 0.008666667 272.1986667 ENVO:human-associated habitat 22.752 1.934666667 26 186.3403333 0 3.239 28.83666667 32.25766667 4.046 0 3.488 0.058 CCME 123.6733333 697.7683333 ctrc 18.11033333 3.617 2.031333333 1297.348667 human gut metagenome 0 1983-01-01 00:00:00 9606 408170 328.3206667 6.45 8.487666667 0.311666667 0.252 1198.517333 5.421 GFIBTIE 9.899666667 88.47366667 Titanium 206.1 45.83633333 3.395666667 5.616333333 1 0.400333333 10.428 5.133333333 426.2056667 0.763333333 10.474 509.3056667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.97366667 1, tablespoon pyrosequencing 2.918 2.295333333 39.64466667 7.364333333 448.1576667 15.52866667 V2 CCME 0 0.067 5.442 723.7323333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3015.01.P1.405218 AGTCACTG CTGCTGCCTYCCGTA n 0 0.117666667 28.0 92.07 353.735 0.002333333 1415.313333 6.551333333 0.077333333 0.017333333 27.468 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 440.627 0.659666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.164666667 26.89333333 8.567666667 3015 0.014333333 12170.78633 1672.170667 1 2009 0.905 5.213666667 -75.2 5.565333333 113 755.4016667 22652.20367 33.61633333 5.646333333 0.071 TCAG 0.202 UBERON:feces 0 1.685 1.058333333 0 55.12633333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.037333333 0.81 243.0423333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 13.47666667 5.022666667 20.718 6.084333333 GAZ:United States of America 0.675 23.261 0 2009 3.483666667 0 4 0.023 5.909 1.506333333 19.24 3.132333333 cm 2.3 6.63 ENVO:human-associated habitat 2336.840667 0.418333333 10.40866667 0.001333333 0.5 0.285666667 0.001333333 None years 3.799 11.725 0.254 PMID:21885721 human gut metagenome 0.256 0 human 299.398 0.021 54.975 ENVO:feces 0 7.321666667 0 317.1143333 10.96566667 Fisher Brand Commode Specimen Collection System 7.402 0.060666667 0.161333333 30.44566667 12296.591 0.805 194.571 48.40566667 13.78166667 135.8323333 0.006333333 229.921 1.185333333 12054 34.88233333 0.149666667 1.052333333 2009 2864.310333 3.368666667 0.078666667 2010 0.0 2853.092667 16.12166667 female 3251.284 78.43433333 0.063666667 149.417 0.189333333 1.589 62.645 1848.254333 3015 9394.345333 5.54 0 1/28/10 0.014666667 213.5736667 3466.882 7733.097667 8.7 PMID18248093 UBERON:feces 117.5216667 13.973 0 143.095 ENVO:human-associated habitat 4.891 4.255666667 28 88.27533333 0 1.791 19.43 24.18933333 2.256333333 0 2.469 0.040333333 CCME 64.06633333 767.874 ctrc 8.88 1.315333333 0.651 2696.886667 human gut metagenome 0 1982-03-01 00:00:00 9606 408170 271.8866667 2.835 5.077666667 0.289 0.063333333 1290.835333 2.910333333 GFIBTIE 29.37066667 78.79633333 Titanium 195.8173333 14.89866667 2.404666667 2.434 0 0.101 6.63 1.9 373.2443333 0.182333333 6.084 647.4546667 12.5 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.25733333 1, tablespoon pyrosequencing 0.920666667 1.800333333 23.15433333 2.823333333 185.0913333 9.867333333 V2 CCME 0 0.017333333 3.35 625.718 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4010.01.P1.405169 ATGCTACG CTGCTGCCTYCCGTA n 0 0.182333333 21.0 39.47566667 265.5943333 0.005 905.2103333 4.082333333 0.090333333 0.028 17.069 UBERON:feces 16S rRNA 2.244666667 23.27 2011 U Penn 227.1783333 0.934333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.923666667 31.44333333 4.499 4010 0.019333333 4623.913 643.7083333 None 2009 1.4 4.69 -75.2 5.653666667 113 460.902 8792.479 34.08866667 2.923666667 0.086333333 TCAG 0.211 UBERON:feces 0 1.540333333 1.269333333 0 56.654 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.934666667 0.516 319.3746667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.80933333 4.005666667 12.91233333 10.13766667 GAZ:United States of America 0.705666667 10.41866667 0 2009 3.192666667 0.008333333 3 0.033333333 12.26766667 0.953333333 9.216333333 2.792 emd 2.441333333 3.565333333 ENVO:human-associated habitat 4124.691667 0.285333333 10.46233333 0.01 0 0.159 0 None years 3.916333333 9.403666667 0.898 PMID:21885721 human gut metagenome 13.87966667 0 human 225.038 8.224666667 52.454 ENVO:feces 0 4.696333333 0 229.8406667 9.589 Fisher Brand Commode Specimen Collection System 7.717666667 0.065333333 0 29.24433333 4785.661333 0.758 193.0153333 52.62866667 15.12933333 74.735 2.501333333 173.664 1.285 2424 28.908 0.167333333 3.054333333 2009 2334.252333 1.389333333 9.899 2010 0.0 3339.345667 14.28966667 female 2658.154333 57.55366667 0.116333333 119.5713333 0.047333333 1.661333333 56.86166667 1665.838333 4010 319.6553333 0.231 11.64866667 3/10/10 0.126333333 170.907 1754.007 6969.868667 1.543 PMID18248093 UBERON:feces 116.139 12.20766667 0.116666667 43.63433333 ENVO:human-associated habitat 10.68433333 1.872 21 90.25266667 0 1.377333333 15.184 25.265 1.972666667 0 1.223 0.005333333 CCME 63.32133333 1050.178 chop 7.919333333 1.531 0.547 1042.513333 human gut metagenome 0 1989-01-01 00:00:00 9606 408170 207.969 3.653333333 3.812666667 0.282 0.105333333 637.41 2.875333333 GFIBTIE 0.944333333 80.97766667 Titanium 239.6526667 15.909 1.566666667 2.932 0 0.154333333 3.565333333 2.564 264.1746667 0.217333333 5.847 244.9033333 1060.228 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.265 1, tablespoon pyrosequencing 1.432333333 1.213333333 20.02433333 5.958333333 137.5273333 5.31 V2 CCME 0 0.026333333 2.698 364.706 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3039.01.S1.405147 AGTCTCAG CTGCTGCCTYCCGTA n 0 0.122 21.0 27.33233333 61.652 0.006333333 916.766 3.613 0.137 0.027333333 11.481 UBERON:feces 16S rRNA 0.031333333 23.27 2011 U Penn 147.274 0.342333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.733 23.99033333 15.46933333 3039 0.028333333 1160.610333 410.871 1 2009 0.986333333 4.103666667 -75.2 4.400333333 113 365.0123333 3017.968 17.78833333 3.196333333 0.215666667 TCAG 0.441 UBERON:feces 0 0.649666667 1.379333333 0 56.35333333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.111666667 0.555666667 30.90533333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 12.53033333 2.435 7.687666667 9.326 GAZ:United States of America 0.366 33.753 0 2009 2.752 0.001666667 2 0.051333333 10.466 1.032666667 38.62266667 2.395 cm 2.108333333 4.643 ENVO:human-associated habitat 2012.714667 0.215666667 8.722666667 0.095666667 0 0.191 0.000666667 None years 3.066333333 12.46733333 0.496 PMID:21885721 human gut metagenome 0.318 0 human 205.142 0.038 24.151 ENVO:feces 0 5.659333333 0 291.8416667 12.69 Fisher Brand Commode Specimen Collection System 11.82266667 0.022666667 0 35.73533333 1183.797333 0.687666667 44.359 59.32066667 18.91433333 103.8583333 0.016666667 401.7976667 1.206 15005 42.70866667 0.339 1.749333333 2009 1087.011667 2.978 0.320333333 2010 0.0 2944.919 9.032 female 1363.693333 60.074 0.067 108.5606667 0.000333333 1.368 53.59866667 1557.716 3039 8297.725667 0.339 6.124333333 5/24/10 0.191666667 155.1276667 1493.072 6517.484667 1.614 PMID18248093 UBERON:feces 79.558 10.79566667 0.001666667 38.90866667 ENVO:human-associated habitat 9.225 1.334333333 21 87.79133333 0 1.311 13.457 33.283 1.867 0 1.546666667 0.085333333 CCME 53.81233333 256.1123333 ctrc 6.027666667 1.766333333 1.263 509.521 human gut metagenome 0 1989-01-01 00:00:00 9606 408170 193.6606667 2.553 3.838666667 0.154666667 0.149666667 642.997 2.43 GVJ07HB 5.526666667 80.52566667 Titanium 100.1526667 20.604 2.098333333 2.402 0 0.102 4.643 2.009333333 149.004 0.166666667 5.632666667 312.2213333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.11733333 1, tablespoon pyrosequencing 1.023 0.854333333 22.395 5.88 127.9626667 6.912 V2 CCME 0 0.007333333 2.456666667 275.237 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3082.01.S2.405176 CTGATGAC CTGCTGCCTYCCGTA n 0 0.125333333 50.0 35.49833333 121.4643333 0.001333333 1229.607667 3.785666667 0.070333333 0.016333333 16.55766667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 173.9433333 0.419666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.165 26.58266667 21.06533333 3082 0.004 999.574 424.819 1 2009 0.759666667 5.478333333 -75.2 5.820666667 108 277.8116667 3005.860667 24.96733333 4.016 0.119333333 TCAG 0.474 UBERON:feces 0 0.977666667 1.872666667 0 55.10733333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.446 0.668 265.6493333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.04666667 2.907 12.54266667 6.637666667 GAZ:United States of America 0.41 10.05133333 0 2009 3.599 0.002666667 3 0.184 9.318333333 0.264666667 11.13166667 3.057333333 LB 2.336333333 5.101666667 ENVO:human-associated habitat 849.9943333 0.265333333 11.34866667 0.001666667 0 0.861 0 None years 4.165666667 12.50266667 0.462666667 PMID:21885721 human gut metagenome 0.049666667 0 human 172.8996667 0 24.086 ENVO:feces 0 5.857333333 0 230.8456667 10.162 Fisher Brand Commode Specimen Collection System 11.61066667 0.017333333 0 44.71433333 1142.931667 0.752 43.679 50.41566667 17.28166667 72.62233333 0 124.4133333 1.461333333 4335 25.93566667 0.287 1.441 2009 1680.029333 4.402333333 0.068 2010 0.0 2243.182667 9.251666667 male 1969.149667 36.508 0.114333333 83.48033333 0 1.712333333 47.30166667 1411.335667 3082 7175.048 2.273666667 9.447 10/7/10 0.035 119.314 2013.385333 5905.029333 2.754333333 PMID18248093 UBERON:feces 78.30533333 14.52266667 0.002 0.705666667 ENVO:human-associated habitat 8.445 1.778 50 83.23133333 0 1.218 14.56133333 32.19933333 2.449333333 0 1.826666667 0.077 CCME 69.66 609.566 citric 9.524666667 2.278 0.796333333 520.063 human gut metagenome 0 1960-01-01 00:00:00 9606 408170 156.2226667 3.242666667 5.313666667 0.176333333 0.025333333 1099.294 3.018 GVJ07HB 23.73866667 78.75566667 Titanium 152.8626667 18.48366667 1.961666667 2.884666667 0 0.109 5.101666667 2.533 249.1936667 0.195666667 4.701666667 329.575 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 20.406 1, tablespoon pyrosequencing 0.767333333 1.013333333 19.51966667 6.09 60.98033333 7.586666667 V2 CCME 0 0.008666667 3.147 234.9236667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3046.01.S1.405128 ATCGATCG CTGCTGCCTYCCGTA n 33.98066667 0.294666667 46.0 10.202 456.0773333 0.034666667 1811.958333 4.125666667 0.059333333 0.053666667 10.89166667 UBERON:feces 16S rRNA 0.02 23.27 2011 U Penn 255.2056667 2.301 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 2.026666667 68.26233333 8.202666667 3046 0.110666667 4421.287333 894.1393333 1 2009 1.451 10.22533333 -75.2 10.512 108 693.0586667 9133.245333 37.825 6.204333333 0.478666667 TCAG 0.048 UBERON:feces 0 1.376666667 2.617333333 0 59.73233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.719666667 1.114 0 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 39.953 3.687666667 6.460666667 6.908333333 GAZ:United States of America 0.942333333 38.56166667 0 2009 6.815666667 0.045333333 2 0.029666667 15.40233333 0.001333333 37.943 5.877666667 cm 5.192 5.135333333 ENVO:human-associated habitat 8010.050333 0.593 22.14366667 0.046333333 0 0.299333333 0 None years 8.636333333 11.584 0.343666667 PMID:21885721 human gut metagenome 0.158333333 10.53766667 human 392.708 0 102.0933333 ENVO:feces 0 5.927333333 0 497.997 24.34133333 Fisher Brand Commode Specimen Collection System 9.561666667 0.082666667 0 98.83666667 4425.389 1.698333333 358.7643333 108.2813333 33.37366667 207.05 0 609.4016667 3.135666667 701 76.172 0.447 1.541666667 2009 2411.483667 4.917 0.14 2010 0.0 5930.2 21.29666667 male 3072.759667 186.663 0.053 234.3516667 0.106666667 3.656 52.322 3100.202 3046 2349.684 4.653 26.57933333 6/14/10 0.007666667 334.848 2773.25 12971.24367 4.578 PMID18248093 UBERON:feces 171.0533333 29.062 0.03 234.0753333 ENVO:human-associated habitat 13.11933333 0.571666667 46 195.4836667 0 2.759333333 24.86566667 28.00833333 4.685666667 0 3.315 0.038666667 CCME 136.9196667 518.4846667 ctrc 13.20866667 3.388666667 2.913666667 1262.922 human gut metagenome 0 1964-01-01 00:00:00 9606 408170 381.8163333 6.886333333 9.491 0.492333333 0.369 1134.011 6.254 GVJ07HB 23.575 85.343 Titanium 680.2573333 37.19333333 4.582 6.328 0 0.250333333 5.135333333 6.266333333 339.3156667 0.217666667 10.22333333 525.357 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 19.69933333 1, tablespoon pyrosequencing 1.641333333 1.758666667 45.25 3.961 257.1353333 7.647666667 V2 CCME 0 0.009666667 5.818333333 512.341 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4027.01.S2.405125 GAGTCTCA CTGCTGCCTYCCGTA n 0 0.169333333 2.0 22.071 71.98133333 0.002333333 1097.294 2.766666667 0.101 0.031666667 6.762333333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 90.101 1.350666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.259 30.40933333 7.543333333 4027 0.005333333 184.8653333 785.7803333 None 2009 0.890333333 5.157 -75.2 4.162 105 511.4756667 2900.301333 18.99166667 3.121 0.050666667 TCAG 0.084333333 UBERON:feces 0 0.631 7.486666667 0 63.85966667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.398666667 0.783 25.31866667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 18.586 1.612666667 4.002 18.88433333 GAZ:United States of America 0.643 32.01466667 0 2010 3.182333333 0.001666667 3 0.017666667 10.07933333 0.067 10.16566667 2.845666667 emd 2.027333333 2.904333333 ENVO:human-associated habitat 264.639 0.367333333 10.13066667 0.036333333 0 0.091333333 0.000333333 None years 4.122666667 13.04166667 0.350666667 PMID:21885721 human gut metagenome 0.073333333 0 human 261.7256667 0.069 56.02966667 ENVO:feces 0 4.999666667 0 203.591 13.594 Fisher Brand Commode Specimen Collection System 13.39466667 0.031333333 0 43.765 201.2963333 0.709666667 34.86 72.84366667 27.86066667 124.6156667 0.026333333 162.8236667 1.34 0 37.05433333 0.956333333 3.683666667 2010 1141.909667 4.944333333 0.028666667 2010 0.0 2950.441667 13.44466667 male 1542.873667 107.623 0.103 161.7406667 0 1.735666667 53.38333333 1943.097667 4027 368.4583333 0.526666667 9.322666667 5/4/10 0.011333333 231.1966667 1342.936 8129.919667 4.565 PMID18248093 UBERON:feces 123.213 13.746 0.005 11.08466667 ENVO:human-associated habitat 9.127666667 0.33 2 86.075 0 1.874 14.004 33.28666667 2.326333333 0 2.385666667 0.071666667 CCME 62.757 173.972 chop 8.330333333 8.506666667 0.955333333 802.555 human gut metagenome 0 2008-01-01 00:00:00 9606 408170 254.9633333 2.635 5.522666667 0.375 0.029333333 1035.978333 2.701333333 GVJ07HB 21.74966667 91.28266667 Titanium 143.9833333 29.257 2.754 2.488 0 0.137666667 2.904333333 2.16 143.328 0.425333333 8.153333333 769.0056667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.367 1, tablespoon pyrosequencing 0.899 1.261333333 28.627 4.594666667 247.6423333 4.313 V2 CCME 0 0.004666667 2.934666667 337.83 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4022.01.S1.405143 GACTCTGA CTGCTGCCTYCCGTA n 60.73933333 0.123 7.0 36.71766667 93.023 0.033333333 1265.807333 3.704666667 0.100666667 0.019 11.793 UBERON:feces 16S rRNA 0.001 23.27 2011 U Penn 122.9413333 0.942 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.365666667 35.18266667 91.129 4022 0.043666667 209.8416667 610.689 None 2009 0.793333333 6.559666667 -75.2 6.860333333 104 442.2046667 2402.582 18.47833333 3.832666667 0.117666667 TCAG 0.183 UBERON:feces 0 0.964333333 3.232333333 0 60.95666667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.378666667 0.679666667 19.52333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 19.50866667 2.275666667 8.079 10.925 GAZ:United States of America 0.481333333 16.425 0 2010 4.236 0.010333333 5 0.047666667 11.99066667 0.693333333 13.13 3.577333333 dhc 3.080666667 4.715333333 ENVO:human-associated habitat 647.2253333 0.338333333 13.31566667 0.025 0 0.187 0 None years 5.411 12.85833333 0.528 PMID:21885721 human gut metagenome 0.029666667 0 human 224.0956667 0.029333333 45.397 ENVO:feces 0.000333333 5.938666667 0 318.437 12.47366667 Fisher Brand Commode Specimen Collection System 12.22733333 0.008666667 0 63.979 265.168 0.940666667 35.611 64.88966667 21.127 104.214 0.012 266.59 1.949666667 1739 38.68 0.502 2.932333333 2010 1579.566333 6.608333333 0.020666667 2010 0.0 3040.325667 14.73333333 male 1942.052 73.58566667 0.137333333 132.4736667 0 2.199 48.06466667 1782.203667 4022 1322.719667 0.84 20.819 4/19/10 0.011 189.3293333 1865.155 7456.74 4.766 PMID18248093 UBERON:feces 101.7216667 15.78066667 0.000333333 29.40566667 ENVO:human-associated habitat 10.65833333 1.109 7 101.426 0 1.694333333 16.584 32.68733333 2.896333333 0 2.254666667 0.098666667 CCME 82.455 500.0786667 chop 11.23666667 3.798 0.772666667 632.7863333 human gut metagenome 0 2003-01-01 00:00:00 9606 408170 211.692 4.082333333 5.796333333 0.235666667 0.091333333 1034.373 3.780666667 GVJ07HB 24.30933333 87.11866667 Titanium 156.418 24.27933333 2.072666667 3.878333333 0 0.104333333 4.715333333 3.410666667 238.703 0.255333333 7.304333333 588.5916667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 19.28766667 1, tablespoon pyrosequencing 0.881333333 1.513666667 25.09966667 5.872333333 187.7303333 7.017666667 V2 CCME 0 0.003666667 3.636666667 310.6716667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3057.01.S2.405177 CAGTCAGT CTGCTGCCTYCCGTA n 0 0.092666667 33.0 83.538 50.89866667 0.006333333 828.694 1.879333333 0.017333333 0.011 5.370333333 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 59.77266667 2.326666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.623 28.81 14.91233333 3057 0.014 244.158 374.0243333 1 2009 1.295666667 3.689333333 -75.2 3.425666667 114 417.3143333 1625.460333 12.31633333 1.883 0.086666667 TCAG 0.030666667 UBERON:feces 0 0.457666667 2.744 0 63.261 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.309 0.539 35.67333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 17.572 1.136333333 3.310333333 13.044 GAZ:United States of America 0.592333333 48.311 0 2009 2.413666667 0.007666667 6 0.062 12.21433333 0.13 51.67766667 2.086666667 cm 1.777666667 3.466333333 ENVO:human-associated habitat 282.0693333 0.250666667 7.647333333 0 0 0.149333333 0 None years 2.778333333 11.41066667 0.54 PMID:21885721 human gut metagenome 0.102 0 human 248.6123333 0 54.333 ENVO:feces 0 4.914 0 108.0973333 9.294666667 Fisher Brand Commode Specimen Collection System 7.765333333 0.013 0 34.63266667 269.4506667 0.674333333 37.823 52.26966667 14.19633333 166.5103333 0 99.05266667 1.072666667 12856 26.572 0.525 3.773 2009 1829.428 3.317 0.065 2010 0.0 2608.500667 11.07266667 female 2155.001667 160.5643333 0.064333333 154.4256667 0 1.247333333 60.72733333 1635.197 3057 2352.990667 0.018666667 7.291333333 8/20/10 0.003333333 220.6466667 894.8736667 6841.664 2.282666667 PMID18248093 UBERON:feces 75.01833333 9.854 0 121.7803333 ENVO:human-associated habitat 10.80266667 0.151666667 33 68.081 0 1.185333333 10.66466667 27.292 1.718666667 0 1.591 0.016666667 CCME 47.41433333 248.2823333 cttrc 4.103666667 3.339 0.574333333 396.4786667 human gut metagenome 0 1977-01-01 00:00:00 9606 408170 243.117 2.032 3.808333333 0.489666667 0.041666667 682.2416667 2.209666667 GVJ07HB 9.756666667 90.38766667 Titanium 98.903 14.983 2.514666667 1.957333333 0 0.081666667 3.466333333 1.728666667 131.1123333 0.264 5.066666667 351.57 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.03066667 1, tablespoon pyrosequencing 1.324333333 0.997 21.40533333 6.238666667 210.2516667 5.15 V2 CCME 0 0.000333333 1.859333333 269.851 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4030.01.S1.405131 GATCTCGA CTGCTGCCTYCCGTA n 0 0.137 20.0 59.08833333 216.295 0.008666667 1179.249333 4.234333333 0.022333333 0.02 17.292 UBERON:feces 16S rRNA 0.002 23.27 2011 U Penn 193.7116667 2.883333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.000666667 38.188 2.536333333 4030 0.021666667 1743.065667 431.6053333 1 2009 2.183333333 5.849 -75.2 6.166666667 107 488.3863333 4022.089 27.26966667 3.893666667 0.146666667 TCAG 0.084666667 UBERON:feces 0 1.269666667 2.168666667 0.000333333 57.79766667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.592666667 0.892666667 219.178 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.23766667 2.795666667 12.88066667 15.14566667 GAZ:United States of America 0.788 42.67166667 0 2009 3.925666667 0.014666667 2 0.077 17.38233333 2.141 55.78833333 3.434666667 cm 2.915333333 7.459333333 ENVO:human-associated habitat 1753.401667 0.350333333 12.532 0.013 0 0.189333333 0 None years 4.916666667 11.894 0.561666667 PMID:21885721 human gut metagenome 0.020666667 0 human 358.125 0 76.16466667 ENVO:feces 0 9.203666667 0 233.4186667 15.648 Fisher Brand Commode Specimen Collection System 9.338333333 0.020333333 0.000333333 49.18233333 1853.922667 1.017 168.3953333 82.84733333 24.55366667 188.837 0 174.9116667 1.677666667 4887 41.952 0.533666667 4.001 2009 2510.924 2.693 0.011 2010 0.0 4041.421667 13.214 male 3022.099667 123.7253333 0.123666667 196.2616667 0 2.141 56.038 2473.728 4030 4499.975 3.185 13.10333333 5/10/10 0.269 280.5073333 2688.765333 10350.07933 5.321 PMID18248093 UBERON:feces 124.179 15.52433333 0.006666667 5.936333333 ENVO:human-associated habitat 15.033 1.788333333 20 106.686 0 1.585 19.36366667 30.24433333 2.682333333 0 1.488 0.017 CCME 76.97766667 698.707 ctrc 8.664 2.752666667 1.197333333 586.0986667 human gut metagenome 0 1990-01-01 00:00:00 9606 408170 340.833 3.715 5.475333333 0.505 0.068 962.811 3.54 GVJ07HB 8.702 82.60366667 Titanium 216.9076667 26.20466667 3.809666667 3.159 0 0.117 7.459333333 2.791666667 289.296 0.473666667 7.464666667 277.1116667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.58166667 1, tablespoon pyrosequencing 2.228333333 1.578 32.87766667 6.752666667 173.197 11.09466667 V2 CCME 0 0.005 3.142 366.9086667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3019.01.P1.405160 AGTCTGAC CTGCTGCCTYCCGTA n 0 0.045 40.0 180.32 218.902 0.017 1156.503333 7.099 0.077 0.008333333 20.08166667 UBERON:feces 16S rRNA 0.003 23.27 2011 U Penn 189.364 0.247 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.204 48.29433333 432.523 3019 0.088 615.725 688.6896667 1 2009 2.115666667 5.599666667 -75.2 6.743333333 108 1317.098 3565.114333 29.41333333 5.388666667 0.169333333 TCAG 0.325666667 UBERON:feces 0 1.522333333 2.747333333 0 59.75466667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 7.089333333 0.292666667 162.4166667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 33.822 4.726 12.93966667 16.36133333 GAZ:United States of America 0.218333333 34.06866667 0 2009 3.807666667 0.003 6 0.112666667 20.56166667 1.316666667 39.98333333 3.255333333 cm 2.713666667 5.869 ENVO:human-associated habitat 963.1766667 0.149333333 11.77 0.019333333 0 0.29 0 None years 4.476333333 7.452666667 1.011 PMID:21885721 human gut metagenome 0.187 0 human 426.7956667 0.086 116.3363333 ENVO:feces 0.004 7.714666667 0 350.045 12.35966667 Fisher Brand Commode Specimen Collection System 8.638 0.007666667 0 42.47566667 913.1853333 0.868333333 71.16266667 75.004 23.897 209.8236667 0.027333333 290.716 1.624666667 12160 37.16933333 0.342666667 4.103666667 2009 3113.009667 7.305 0.082333333 2010 0.0 3940.213333 23.15 male 3706.78 140.986 0.162333333 245.917 0.148333333 1.992333333 62.95366667 2636.288333 3019 5003.206333 4.475 14.88266667 2/15/10 0.159333333 351.466 3506.468333 11030.23133 3.413 PMID18248093 UBERON:feces 171.2946667 15.03433333 0.000666667 111.49 ENVO:human-associated habitat 18.12766667 3.336333333 40 127.497 0 2.904333333 20.549 25.739 2.484 0 2.985333333 0.043666667 CCME 72.10933333 650.6416667 ctrc 17.67733333 3.129666667 0.719666667 764.7883333 human gut metagenome 0 1970-06-01 00:00:00 9606 408170 406.7143333 3.754333333 4.739666667 0.117 0.126333333 1040.708667 3.219333333 GFIBTIE 15.73166667 85.40266667 Titanium 139.2563333 25.29 1.065666667 3.356333333 0 0.036666667 5.869 2.837 330.6063333 0.422666667 7.435 612.5903333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 11.215 1, tablespoon pyrosequencing 2.227666667 3.213666667 22.40933333 7.316666667 663.522 8.735333333 V2 CCME 0 0.011333333 3.396 852.886 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3071.01.S3.405212 CGCGATAT CTGCTGCCTYCCGTA n 176.8116667 0.200666667 25.0 190.5706667 376.4156667 0.011666667 1906.899 8.477333333 0.071333333 0.027 27.83066667 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 407.519 1.361666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.844 84.33266667 62.32333333 3071 0.039333333 7069.745333 1826.570667 1 2009 1.613333333 9.466333333 -75.2 9.321333333 107 1710.965333 16051.214 51.465 10.75266667 0.173666667 TCAG 0.469333333 UBERON:feces 0 1.734666667 2.965333333 0.004666667 56.466 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 8.336333333 1.260666667 147.7336667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 57.96533333 6.096666667 18.534 13.96266667 GAZ:United States of America 1.510333333 16.08033333 33.828 2009 6.19 0.021666667 0 0.269333333 15.24366667 0.527666667 17.43433333 5.620333333 cm 4.355666667 22.98133333 ENVO:human-associated habitat 4550.758667 0.66 19.94266667 0.000666667 0 0.460666667 0.000333333 None years 6.971666667 11.40233333 0.445 PMID:21885721 human gut metagenome 0.11 0 human 348.324 13.957 48.48033333 ENVO:feces 0 43.32233333 0 386.7613333 16.354 Fisher Brand Commode Specimen Collection System 8.367 0.109666667 0.000333333 71.04666667 7174.773667 1.582 265.1213333 80.196 23.12766667 102.9016667 3.483 296.4566667 2.607666667 8983 49.04066667 0.478333333 3.174333333 2009 3705.661667 11.18066667 0.307333333 2010 0.0 4019.443667 41.57133333 male 4259.257333 49.13633333 0.180666667 182.07 0 3.174666667 51.39266667 2661.586333 3071 8209.558333 1.013333333 14.789 9/16/10 0.030666667 260.1933333 3521.424333 11136.07733 1.699 PMID18248093 UBERON:feces 194.922 27.306 0 258.2476667 ENVO:human-associated habitat 13.316 2.902666667 25 191.905 0 3.889 26.112 26.88866667 4.195666667 0 5.371333333 0.082333333 CCME 122.512 956.076 ctrc 15.90733333 3.589 1.159 2424.469 human gut metagenome 0 1985-01-01 00:00:00 9606 408170 319.5456667 5.586 9.773333333 0.542333333 0.127333333 1672.838333 5.583 GVJ07HB 18.74666667 80.69366667 Titanium 437.8886667 24.83066667 4.189666667 5.047 0 0.173333333 7.758666667 4.270333333 452.8696667 0.769333333 6.808333333 1228.673333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.274 1, tablespoon pyrosequencing 1.686 4.724 33.879 5.073 737.022 45.35633333 V2 CCME 0 0.021 5.640666667 1144.540667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3080.01.S2.405215 CTGAGACT CTGCTGCCTYCCGTA n 51.81966667 0.179 40.0 72.509 196.9243333 0.238333333 1879.601667 7.784 0.208333333 0.051 32.11666667 UBERON:feces 16S rRNA 0.236333333 23.27 2011 U Penn 359.424 1.024666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.632333333 59.50666667 160.8913333 3080 0.327666667 2241.350333 639.482 1 2009 1.94 9.388333333 -75.2 10.39866667 108 1093.841 5447.774667 42.201 6.945333333 0.466666667 TCAG 0.424 UBERON:feces 0 1.63 4.183 0.001333333 60.64166667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.792333333 0.348333333 133.8766667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 35.797 3.995333333 23.63366667 20.22 GAZ:United States of America 0.307333333 29.88733333 9.631 2009 5.996 0.053 0 0.096 26.75666667 1.512666667 23.26866667 5.187333333 LB 4.579 15.64666667 ENVO:human-associated habitat 4000.127667 0.125 18.76166667 0.546666667 1.333333333 0.328333333 0 None years 7.752 9.143666667 0.887333333 PMID:21885721 human gut metagenome 1.834333333 3.512666667 human 386.3983333 5.403 58.30766667 ENVO:feces 0.013333333 23.275 0 436.117 18.30533333 Fisher Brand Commode Specimen Collection System 10.696 0.087 0.078333333 73.72133333 2388.734667 1.422666667 217.735 105.0446667 34.47166667 130.667 1.769666667 363.7433333 2.661666667 7684 50.309 1.225333333 3.777 2009 3489.390333 8.942333333 1.183333333 2010 0.0 6755.1 22.863 male 4049.437 114.416 0.115333333 221.267 0 3.079333333 52.926 2961.255333 3080 6257.944333 0.544333333 26.794 11/18/10 0.042 316.2153333 3092.889667 12389.89233 7.122333333 PMID18248093 UBERON:feces 204.2266667 22.52033333 0.014 13.568 ENVO:human-associated habitat 23.71 3.718333333 40 214.57 0 2.78 29.09666667 29.38266667 3.854666667 0 2.986333333 0.161333333 CCME 115.9353333 1084.753333 citric 15.04633333 5.544 1.963666667 838.543 human gut metagenome 0 1970-01-01 00:00:00 9606 408170 352.9486667 5.95 7.511333333 0.137333333 0.208 1188.537667 5.246333333 GVJ07HB 11.75233333 86.667 Titanium 203.8823333 37.74966667 2.142666667 5.727666667 0 0.151333333 11.31266667 4.827 425.8163333 0.679 8.737333333 440.4206667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.83933333 1, tablespoon pyrosequencing 2.572333333 2.709 31.80366667 7.047666667 431.961 26.49633333 V2 CCME 0 0.017333333 5.274333333 791.385 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3026.01.P1.405223 CAGTGACT CTGCTGCCTYCCGTA n 0 0.323 24.0 46.89766667 141.517 0.012 1764.398 6.095 0.136 0.046666667 15.019 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 208.1276667 1.208333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.563 53.12666667 14.27666667 3026 0.034333333 948.8946667 593.6846667 1 2009 3.189 8.633333333 -75.2 8.885333333 107 671.839 3446.912 31.629 4.911666667 0.366 TCAG 0.398666667 UBERON:feces 0 1.217 3.445666667 0.000333333 60.81733333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.461 1.654333333 196.084 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 28.16233333 2.932666667 8.016333333 14.65066667 GAZ:United States of America 1.361 33.47066667 0 2009 5.631 0.017 0 0.14 30.444 0.950666667 44.59733333 4.922 cm 4.265666667 9.309666667 ENVO:human-associated habitat 454.783 0.728666667 18.31866667 0.037 0 0.426666667 0 None years 6.804 13.35 0.615333333 PMID:21885721 human gut metagenome 0.21 0 human 355.2776667 7.722 62.06966667 ENVO:feces 0 10.99766667 0 315.3393333 23.565 Fisher Brand Commode Specimen Collection System 10.91566667 0.056333333 0 81.32266667 1054.075333 1.498 107.134 122.601 35.11833333 154.9333333 1.864333333 262.81 2.533666667 11583 58.91333333 0.689333333 3.969333333 2009 2524.825667 5.404 0.146 2010 0.0 5570.644 20.51133333 male 3110.354 107.3523333 0.179666667 208.1423333 0 3.009 47.75766667 3016.988333 3026 10786.71333 0.419 21.55633333 3/18/10 0.140333333 297.4003333 2495.059667 12623.07933 4.835333333 PMID18248093 UBERON:feces 161.3936667 23.84933333 0 63.936 ENVO:human-associated habitat 26.97666667 1.307333333 24 142.663 0 2.701333333 25.67166667 34.5 4.006666667 0 2.679666667 0.062333333 CCME 113.1546667 352.2923333 ctrc 15.86333333 4.261 2.235 681.5243333 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 340.2583333 5.181333333 8.878 0.568 0.099666667 1459.074667 5.026666667 GFIBTIE 9.533666667 86.899 Titanium 192.7603333 38.10133333 5.162333333 5.015 0 0.275666667 9.309666667 4.722333333 263.0936667 0.459666667 10.11233333 505.845 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.79066667 1, tablespoon pyrosequencing 3.253 1.973 45.31933333 7.793 272.6053333 13.85633333 V2 CCME 0 0.007333333 4.730666667 480.7323333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3074.01.S1.405182 CTAGACGT CTGCTGCCTYCCGTA n 110.6666667 0.127666667 30.0 149.2206667 239.435 0.003666667 1608.343333 5.998 0.112 0.014666667 20.19633333 UBERON:feces 16S rRNA 2.273333333 23.27 2011 U Penn 294.032 0.561666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.673 35.96866667 19.83566667 3074 0.027666667 2402.621333 725.664 1 2009 1.906 7.085666667 -75.2 7.558 107 540.7003333 5779.675333 48.901 6.262666667 0.083 TCAG 0.258 UBERON:feces 0 1.500333333 1.622333333 0 63.61 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 6.565333333 0.948 10.18 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 17.81466667 5.303 13.74266667 17.151 GAZ:United States of America 0.586333333 29.91366667 0 2009 4.724333333 0 0 0.082 18.768 0.427333333 29.414 4.372333333 LB 3.097666667 7.063666667 ENVO:human-associated habitat 1698.106 0.392333333 14.22733333 0.002333333 0 0.527666667 0.002666667 None years 4.716666667 9.358333333 0.877666667 PMID:21885721 human gut metagenome 13.834 0 human 345.8056667 12.51066667 23.83833333 ENVO:feces 0 9.015 0 415.53 13.17433333 Fisher Brand Commode Specimen Collection System 7.462333333 0.012 0.05 37.536 2417.629333 1.089333333 113.8683333 69.627 19.036 112.5646667 3.834666667 395.5353333 1.807333333 8155 45.685 0.327 4.592333333 2009 2150.812 3.760666667 10.273 2010 0.0 5937.998333 23.079 male 2601.811333 52.51166667 0.118 205.4373333 0.000666667 2.067333333 56.55566667 2404.226333 3074 10718.95267 0.063333333 0 10/14/10 0.151333333 293.6043333 3374.374 10059.28267 3.883333333 PMID18248093 UBERON:feces 191.1426667 20.206 0.091333333 104.24 ENVO:human-associated habitat 16.69733333 2.155 30 129.7296667 0 2.108666667 29.00333333 25.332 3.278333333 0 2.745666667 0.09 CCME 86.474 840.7416667 ctrc 11.95233333 1.972 0.831 927.1326667 human gut metagenome 0 1980-01-01 00:00:00 9606 408170 324.6756667 4.141666667 7.2 0.271 0.109666667 1367.181667 4.094666667 GVJ07HB 24.988 90.90733333 Titanium 124.5296667 20.24433333 2.724333333 3.372666667 0 0.112666667 7.063666667 2.698666667 337.3073333 0.476666667 6.011 524.195 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.15033333 1, tablespoon pyrosequencing 1.936666667 1.507 25.65233333 6.658333333 145.114 10.50933333 V2 CCME 0 0.022 4.566333333 439.1456667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4014.01.P1.405150 CACTGTGA CTGCTGCCTYCCGTA n 157.8666667 0.126 18.0 86.764 345.4543333 0.007666667 1458.871667 5.230666667 0.033666667 0.018 17.544 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 279.2196667 0.524333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.196666667 40.438 130.6733333 4014 0.029333333 4604.011333 996.3856667 1 2009 0.829666667 7.676333333 -75.2 7.261 106 655.51 10043.64167 22.69033333 4.761666667 0.069 TCAG 1.074666667 UBERON:feces 0 0.955666667 0.489666667 0 56.09233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 0.757 0.842 336.629 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 22.14666667 3.553333333 12.17133333 5.87 GAZ:United States of America 0.541 8.692 0 2009 5.184 0.012 0 0.02 15.311 0.555333333 14.776 4.174 dhc 3.518 8.943333333 ENVO:human-associated habitat 4645.216 0.328333333 14.42733333 0.001666667 0 4.958 0.002666667 None years 6.138 11.45266667 0.707666667 PMID:21885721 human gut metagenome 0.091333333 17.56266667 human 204.374 0 28.87 ENVO:feces 0 9.748666667 0 254.009 11.17 Fisher Brand Commode Specimen Collection System 8.280333333 0.028333333 0.075 67.19566667 4837.662 1.097666667 192.9773333 58.00633333 14.40166667 71.68866667 0 265.926 2.169 4517 35.481 0.273666667 1.272 2009 3414.402 3.449 0.033 2010 0.0 2525.1 15.203 male 3748.727333 21.79733333 0.041 104.7763333 0.071333333 2.323333333 47.766 1681.532667 4014 5868.524 9.547 9.005666667 3/15/10 0.031333333 149.7153333 2419.184333 7035.531667 1.51 PMID18248093 UBERON:feces 102.9386667 18.38066667 0.004333333 94.91166667 ENVO:human-associated habitat 14.261 2.587 18 97.74333333 0 1.745 17.85833333 30.28933333 3.382666667 0 2.424333333 0.028333333 CCME 89.723 918.913 chop 10.09866667 0.802333333 0.986333333 1399.524333 human gut metagenome 0 1992-01-01 00:00:00 9606 408170 186.83 3.81 7.339333333 0.254 0.106 1482.259 4.423333333 GFIBTIE 12.88266667 80.15066667 Titanium 187.2373333 15.827 2.834333333 3.960666667 0 0.111 8.943333333 2.926 279.25 0.514666667 4.565666667 593.247 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 22.00533333 1, tablespoon pyrosequencing 0.878333333 1.608333333 21.96533333 8.005666667 221.267 13.32333333 V2 CCME 0 0.018333333 4.327 500.4866667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3060.01.S1.405136 CAGTGACT CTGCTGCCTYCCGTA n 0 0.275666667 22.0 105.4766667 148.0256667 0.008 1941.781 5.703333333 0.052333333 0.045 19.53133333 UBERON:feces 16S rRNA 0.047666667 23.27 2011 U Penn 295.1753333 0.896 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.795666667 62.513 9.354333333 3060 0.023666667 3705.818667 873.6876667 1 2009 1.634333333 10.72633333 -75.2 10.834 113 875.8276667 8343.192667 38.55133333 5.610666667 0.162 TCAG 0.259 UBERON:feces 0 1.333 4.697 0 48.97666667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.059333333 1.528666667 403.431 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 38.69233333 3.769333333 13.85366667 14.69533333 GAZ:United States of America 0.924333333 14.78866667 0 2009 6.863333333 0.015666667 2 0.062333333 15.631 0.054666667 9.759 5.977333333 cm 4.944 8.198333333 ENVO:human-associated habitat 2049.802333 0.654333333 21.91766667 0 0 0.351333333 0 None years 9.580666667 13.87066667 0.434666667 PMID:21885721 human gut metagenome 0.103 0 human 295.5253333 34.749 18.16 ENVO:feces 0 9.899 0 455.713 24.00533333 Fisher Brand Commode Specimen Collection System 11.231 0.088 0 97.16733333 3912.211667 1.429333333 158.478 104.4293333 33.60366667 60.03333333 8.006 302.7523333 3.142666667 14848 59.806 0.778 3.011333333 2009 3177.978667 5.707666667 0.156666667 2010 0.0 5133.289333 20.44333333 female 3730.209 40.23566667 0.107666667 135.0616667 0 3.982333333 40.74433333 2887.071667 3060 10990.08833 0.315666667 30.331 9/14/10 0.023333333 193.024 3008.023667 12079.508 4.656 PMID18248093 UBERON:feces 169.5823333 28.071 0.013 44.77333333 ENVO:human-associated habitat 13.737 1.877 22 171.28 0 2.143666667 27.67766667 32.437 4.871666667 0 2.644333333 0.175 CCME 135.7303333 648.6896667 ctrc 17.46933333 5.609333333 1.831 1199.705333 human gut metagenome 0 1988-01-01 00:00:00 9606 408170 275.994 6.910666667 9.897666667 0.421 0.112666667 1595.808333 6.105 GVJ07HB 12.319 69.99633333 Titanium 224.9363333 36.219 4.965666667 6.180666667 0 0.230333333 8.198333333 5.526333333 399.872 0.503666667 9.704 547.6703333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 19.03833333 1, tablespoon pyrosequencing 1.681666667 2.785 44.226 4.767666667 341.6806667 12.21466667 V2 CCME 18.31266667 0.007 5.917333333 636.8566667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3055.01.S1.405195 CACAGTGT CTGCTGCCTYCCGTA n 34.1 0.073333333 28.0 189.7813333 388.9833333 0.141 1575.425667 13.70333333 0.094333333 0.009333333 45.359 UBERON:feces 16S rRNA 0 23.27 2011 U Penn 322.5193333 0.716333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.278 36.80666667 152.3646667 3055 0.159666667 6945.310333 995.0773333 1 2009 0.919 6.016666667 -75.2 7.964666667 113 545.651 14542.378 37.77233333 6.814 0.094333333 TCAG 2.668 UBERON:feces 0 2.035 0.637 0.002333333 56.89633333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.722333333 0.533 2121.392667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.717 4.541 31.25433333 5.631666667 GAZ:United States of America 0.419666667 27.80333333 0 2009 4.007333333 0.030333333 3 0.035666667 11.248 2.274333333 38.447 3.576333333 cm 2.861 12.86466667 ENVO:human-associated habitat 2244.173333 0.209333333 13.047 0.012666667 0 0.189 0 None years 4.841333333 6.525333333 0.685333333 PMID:21885721 human gut metagenome 0.023 34.1 human 358.8943333 0.12 57.16666667 ENVO:feces 0 13.58766667 0 356.5503333 8.466 Fisher Brand Commode Specimen Collection System 8.625666667 0.074666667 0 41.19733333 8082.19 0.905666667 112.1243333 54.408 20.87833333 147.6856667 0.046 187.9053333 1.626 15886 25.67666667 0.113666667 0.93 2009 2852.146667 3.708 0.093666667 2010 0.0 3658.111 21.95233333 female 3347.849667 45.44966667 0.076333333 178.27 0 1.999 63.474 2156.741333 3055 1357.032667 2.168333333 10.87033333 8/19/10 0.042333333 254.8303333 5642.031 9023.806 4.470666667 PMID18248093 UBERON:feces 145.729 17.64 0.003666667 64.424 ENVO:human-associated habitat 9.816 8.461333333 28 107.651 0 1.863666667 30.36666667 21.67866667 2.660333333 0 2.434 0.114333333 CCME 78.96933333 897.7876667 ctrc 11.401 0.865 0.602666667 1668.593667 human gut metagenome 0 1982-01-01 00:00:00 9606 408170 313.462 4.012333333 5.575666667 0.196666667 0.09 1135.715667 3.381333333 GVJ07HB 19.609 81.33066667 Titanium 281.0623333 21.77933333 1.695666667 3.437333333 0 0.063666667 12.86466667 3.092 478.3753333 0.376666667 3.455 321.562 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.81733333 1, tablespoon pyrosequencing 1.249666667 2.781333333 16.12066667 4.416666667 131.2193333 19.17166667 V2 CCME 0 0.042666667 3.668666667 453.7386667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3029.01.S1.405198 ACTCGTGA CTGCTGCCTYCCGTA n 0 0.073333333 23.0 52.827 287.2183333 0.03 1357.209667 5.540666667 0.045 0.011 16.614 UBERON:feces 16S rRNA 0.281666667 23.27 2011 U Penn 140.0993333 0.341333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.226666667 69.65366667 14.84733333 3029 0.144666667 619.252 179.1946667 1 2009 1.661666667 8.435 -75.2 9.569 107 499.416 1477.861667 25.471 11.213 0.168 TCAG 0.763333333 UBERON:feces 0 1.301666667 2.874666667 0 61.78133333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.816 0.354333333 13.676 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 48.171 2.402333333 10.704 12.96166667 GAZ:United States of America 0.231333333 20.21266667 9.853 2009 5.484666667 0.024666667 2 0.054 18.34333333 0.384 19.23366667 4.575 cm 4.271 14.46433333 ENVO:human-associated habitat 1057.801333 0.100666667 17.20833333 0.019333333 1 0.183 0 None years 7.794333333 7.253 1.283333333 PMID:21885721 human gut metagenome 1.717 0 human 217.1813333 9.266333333 25.67866667 ENVO:feces 0.006666667 21.34266667 0 273.4973333 8.754 Fisher Brand Commode Specimen Collection System 11.18633333 0.061333333 0 80.04333333 633.5136667 1.289 95.169 65.56933333 24.23766667 72.08233333 3.816 195.7746667 2.481333333 11603 25.38833333 0.765666667 4.481 2009 3005.877333 7.893666667 1.204333333 2010 0.0 2738.593667 13.72366667 male 3398.086333 50.03733333 0.083666667 123.0063333 0 3.084666667 43.06233333 1924.735667 3029 1751.341667 0.045333333 30.34433333 4/20/10 0.015666667 175.8066667 2266.045333 8053.094667 2.909 PMID18248093 UBERON:feces 108.427 20.838 0.003333333 229.34 ENVO:human-associated habitat 16.22666667 1.888333333 23 156.4576667 0 1.796 16.15966667 29.16366667 3.820333333 0 3.287666667 0.053 CCME 105.6056667 613.5853333 ctrc 10.24 3.707 0.669666667 231.9873333 human gut metagenome 0 1987-01-01 00:00:00 9606 408170 199.562 6.024333333 6.517 0.097333333 0.161666667 836.453 4.955 GVJ07HB 3.865666667 88.30733333 Titanium 241.2296667 25.239 1.105666667 5.096666667 0 0.062 10.03033333 4.293333333 328.7763333 0.293666667 3.995333333 126.4016667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 24.12233333 1, tablespoon pyrosequencing 1.867 5.686333333 15.445 7.894333333 211.199 24.79433333 V2 CCME 0 0.013 4.622 351.2983333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3045.01.S2.405207 ATATGCGC CTGCTGCCTYCCGTA n 0 0.181666667 22.0 137.8103333 271.997 0.144333333 1324.784333 6.997333333 0.102666667 0.028666667 23.18933333 UBERON:feces 16S rRNA 0.039666667 23.27 2011 U Penn 278.4543333 0.591333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.219 48.56166667 58.47866667 3045 0.480666667 2721.282667 555.1553333 1 2009 3.374333333 6.581333333 -75.2 8.032 113 511.8953333 5705.423667 30.14333333 5.708 0.407333333 TCAG 0.421333333 UBERON:feces 0 1.372 2.074 0 53.52633333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 7.208 0.811666667 48.69333333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 31.655 3.485666667 16.01466667 25.97666667 GAZ:United States of America 0.597666667 17.24066667 0 2009 4.381333333 0.119666667 4 0.160333333 27.82066667 0.149333333 17.075 3.741333333 cm 3.290666667 11.33166667 ENVO:human-associated habitat 4894.310333 0.429 14.40333333 0.103 0 0.242666667 0.002666667 None years 6.201333333 10.181 0.996666667 PMID:21885721 human gut metagenome 0.445 0 human 277.214 32.95133333 50.48866667 ENVO:feces 0.03 14.20433333 0 390.0023333 16.74966667 Fisher Brand Commode Specimen Collection System 12.168 0.038666667 0 59.008 2774.872667 1.014666667 267.7203333 99.343 32.65133333 96.89666667 9.199333333 299.2836667 2.023333333 10555 45.05466667 0.445666667 7.752 2009 2520.801333 4.096 0.277666667 2010 0.0 3553.623 14.38233333 female 2991.542667 67.91 0.213 135.9916667 0.229666667 2.373333333 42.80066667 2552.075333 3045 1500.113333 0.843333333 23.40333333 6/3/10 0.071 194.379 2959.710333 10677.88233 2 PMID18248093 UBERON:feces 121.9103333 16.057 0.003666667 18.48133333 ENVO:human-associated habitat 23.377 3.809333333 22 143.9293333 0 1.519333333 20.30266667 34.196 2.909 0 1.923 0.090666667 CCME 89.14933333 510.6936667 ctrc 10.75633333 2.651 0.999333333 786.3943333 human gut metagenome 0 1988-01-01 00:00:00 9606 408170 254.0246667 4.925666667 5.112333333 0.298333333 0.219 741.137 3.951 GVJ07HB 9.849333333 76.50566667 Titanium 177.8186667 34.694 2.362333333 4.273333333 0 0.151666667 11.33166667 3.793333333 334.2056667 0.494333333 6.702333333 323.9156667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.98966667 1, tablespoon pyrosequencing 4.148666667 2.489333333 29.79266667 9.465 137.3533333 16.88566667 V2 CCME 0 0.033 3.755 415.8073333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3085.01.S2.405151 CTGTGACA CTGCTGCCTYCCGTA n 0 0.047333333 21.0 114.365 167.2316667 0.001333333 892.122 4.941 0.007 0.017333333 15.59 UBERON:feces 16S rRNA 5.685333333 23.27 2011 U Penn 173.0563333 0.126333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.890333333 32.58466667 57.97633333 3085 0.004333333 2920.786667 602.0206667 1 2009 1.532666667 4.641666667 -75.2 6.598666667 113 274.4896667 6985.624667 39.63233333 2.782333333 0.323333333 TCAG 0.174 UBERON:feces 0 1.347 1.875 0.001 64.183 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.872333333 0.065 1271.498 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.41133333 2.735 10.55733333 22.02866667 GAZ:United States of America 0.066666667 26.64933333 12.11333333 2009 2.976666667 0.002666667 0 0.580333333 19.681 0.050333333 20.174 2.847666667 cm 2.306333333 12.22033333 ENVO:human-associated habitat 460.939 0.020333333 10.732 0 0 0.163 0 None years 3.829333333 8.962 1.191 PMID:21885721 human gut metagenome 23.12433333 0 human 228.313 0 17.96366667 ENVO:feces 0 21.40333333 0 206.2126667 10.192 Fisher Brand Commode Specimen Collection System 12.89666667 0.014 0.000333333 24.17733333 3585.524 0.670666667 62.34333333 68.033 25.26333333 76.20166667 0 71.55333333 1.192 3021 21.07066667 0.472 10.368 2009 1789.502 6.111666667 22.26433333 2010 0.0 2026.487 11.66466667 female 2117.667333 48.023 0.302666667 133.4766667 4.503333333 1.726333333 51.59333333 1756.18 3085 0.204333333 2.145333333 11.50566667 10/25/10 0.309333333 190.811 2231.149667 7347.857 9.474 PMID18248093 UBERON:feces 124.8183333 12.4 0.146666667 15.15266667 ENVO:human-associated habitat 18.063 2.818333333 21 70.941 0 1.126333333 12.74233333 33.98633333 2.096333333 0 0.959666667 0.073666667 CCME 64.12066667 653.2896667 ctrc 7.633 2.373666667 0.532333333 900.8146667 human gut metagenome 0 1989-01-01 00:00:00 9606 408170 212.723 4.618 3.462666667 0.019666667 0.044666667 735.3123333 2.623 GVJ07HB 1.777333333 91.75533333 Titanium 29.87133333 26.33233333 0.647666667 3.120666667 0 0.029666667 6.769333333 3.184 277.3723333 0.534 5.087666667 303.227 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.488 1, tablespoon pyrosequencing 1.541 1.504 17.31966667 9.7 59.62066667 22.21333333 V2 CCME 0 0.010333333 3.004 232.677 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3064.01.S1.405171 CATGAGCT CTGCTGCCTYCCGTA n 1.166666667 0.04 30.0 185.1186667 113.0386667 0.091 769.433 4.342333333 0.013333333 0.008666667 14.582 UBERON:feces 16S rRNA 0.013666667 23.27 2011 U Penn 186.736 0.075666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.871666667 32.78733333 752.1 3064 0.193333333 4302.505667 638.4633333 1 2009 0.815 4.294333333 -75.2 5.529666667 113 504.232 9167.71 19.81833333 4.700666667 0.226666667 TCAG 0.270666667 UBERON:feces 0 1.096 0.909666667 0.009333333 62.317 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.662 0.043 791.039 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.59766667 2.019 10.29933333 7.256666667 GAZ:United States of America 0.063333333 19.99466667 2.794333333 2009 2.853 0.039666667 3 0.031 10.296 0.445 27.756 2.462 LB 2.281 6.865666667 ENVO:human-associated habitat 1179.437333 0.03 9.635666667 0.091 0 0.029333333 0 None years 4.212333333 6.212 1.227333333 PMID:21885721 human gut metagenome 0.035666667 1.166666667 human 177.9913333 0.008 29.71066667 ENVO:feces 0.000333333 9.332 0 275.472 5.196 Fisher Brand Commode Specimen Collection System 8.531666667 0.012 0 39.91966667 5074.075 0.671333333 71.57966667 33.794 10.99766667 84.33833333 0.006333333 160.0113333 1.337 14901 16.592 0.164333333 2.083333333 2009 2130.789667 5.257333333 0.032333333 2010 0.0 4700.851667 13.71433333 female 2399.745 15.275 0.046666667 101.453 0.088 1.545333333 55.78 1219.570667 3064 26006.18733 0 16.19933333 11/24/10 0.295333333 144.986 2776.311333 5102.683333 0.519333333 PMID18248093 UBERON:feces 63.41866667 11.28866667 0.003 0 ENVO:human-associated habitat 8.986 3.548333333 30 85.47466667 0 1.309 20.474 23.91233333 1.863666667 0 1.306666667 0.017666667 CCME 59.73466667 548.3253333 ctrc 5.848666667 1.102333333 0.570333333 1061.303 human gut metagenome 0 1980-01-01 00:00:00 9606 408170 163.4093333 3.533666667 3.26 0.021666667 0.101 422.8003333 2.625 GVJ07HB 6.328 89.05733333 Titanium 203.1923333 11.958 0.424666667 2.887666667 0 0.032333333 5.608 2.690333333 231.7236667 0.457666667 2.487333333 215.6236667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 20.519 1, tablespoon pyrosequencing 1.139333333 2.278333333 8.506333333 7.003666667 186.7053333 11.141 V2 CCME 0 0.062 2.451333333 373.4413333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3069.01.S1.405159 CGATGCAT CTGCTGCCTYCCGTA n 0 0.199333333 24.0 116.023 230.5523333 0.001666667 1540.874333 5.993333333 0.025 0.038 24.61566667 UBERON:feces 16S rRNA 0.033 23.27 2011 U Penn 257.328 1.167666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.269666667 38.65066667 773.116 3069 0.012333333 2630.205667 475.0296667 1 2009 1.587333333 7.156333333 -75.2 7.663 107 444.2943333 5878.581 29.68133333 4.930666667 0.105666667 TCAG 0.415333333 UBERON:feces 0 1.548666667 1.409666667 0.000333333 60.66933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.231333333 0.691 154.7686667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 22.51633333 2.746 18.359 12.22033333 GAZ:United States of America 0.528333333 21.32966667 0 2009 4.647 0 0 0.056666667 17.26666667 0.005 19.03666667 4.359666667 cm 3.436666667 10.02266667 ENVO:human-associated habitat 2097.094667 0.223 14.98533333 0.006333333 0 0.442333333 0.005666667 None years 6.370333333 12.747 0.717 PMID:21885721 human gut metagenome 1.076666667 0 human 225.0276667 0.039333333 44.79833333 ENVO:feces 0.000333333 11.462 0 348.5693333 17.77833333 Fisher Brand Commode Specimen Collection System 13.712 0.058666667 0.150333333 62.86233333 3094.132 0.968 111.3253333 90.62633333 29.98133333 91.364 0.011666667 309.2816667 2.150333333 9701 47.71333333 0.383666667 2.701333333 2009 2815.706667 3.516666667 0.260666667 2010 0.0 3943.833667 14.78966667 male 3200.976667 70.13466667 0.091 122.1973333 0.088666667 2.743333333 45.321 2053.092333 3069 2435.773333 1.154 20.82166667 9/16/10 0.250333333 174.6366667 2780.986667 8590.137 2.394 PMID18248093 UBERON:feces 101.402 18.42966667 0.012666667 23.53133333 ENVO:human-associated habitat 15.55366667 3.905333333 24 120.4123333 0 1.774333333 22.17966667 36.944 3.205666667 0 1.666333333 0.137333333 CCME 92.564 751.6166667 ctrc 13.096 1.879666667 2.930333333 732.874 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 200.057 5.131666667 6.205 0.323333333 0.090666667 1078.152 4.043666667 GVJ07HB 3.363333333 86.70566667 Titanium 138.8626667 33.61366667 3.158 4.357333333 0 0.161333333 10.02266667 4.009333333 297.332 0.476333333 6.985 217.1853333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 17.614 1, tablespoon pyrosequencing 1.602666667 1.846 31.92966667 7.238666667 109.8986667 14.95733333 V2 CCME 0 0.001 4.35 367.2266667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3023.01.P1.405163 AGTGTCAC CTGCTGCCTYCCGTA n 830.1023333 0.313666667 40.0 217.6753333 244.7633333 0.009 2104.492667 6.688333333 0.129666667 0.065 25.35233333 UBERON:feces 16S rRNA 1.418666667 23.27 2011 U Penn 465.626 1.027 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.692666667 68.90466667 648.842 3023 0.035333333 6633.702 1009.696 1 2009 2.102666667 9.86 -75.2 10.74066667 108 961.8136667 13939.94667 60.32166667 6.952666667 0.328 TCAG 0.489333333 UBERON:feces 0 1.699 2.193333333 0 53.09566667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 3.925333333 1.012 1316.405 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 42.622 5.904333333 18.35866667 11.48933333 GAZ:United States of America 0.760333333 24.88933333 0 2009 6.505333333 0.015 0 0.049 15.32333333 0.143666667 18.52033333 5.749666667 cm 4.967666667 9.253333333 ENVO:human-associated habitat 4897.750333 0.496 22.17866667 0.120333333 0 0.480666667 0.006333333 None years 7.703 9.735333333 0.436333333 PMID:21885721 human gut metagenome 8.905666667 0 human 405.834 52.91566667 35.47933333 ENVO:feces 0 10.549 0 569.7633333 20.68066667 Fisher Brand Commode Specimen Collection System 8.690666667 0.112666667 1.829666667 76.16566667 7616.325333 1.577 237.243 97.32766667 30.82166667 96.77066667 11.93466667 369.5413333 2.741 7591 57.276 0.47 1.947333333 2009 4884.116667 6.256333333 6.406 2010 0.0 6390.139333 26.84966667 male 5541.817 36.283 0.093333333 203.9043333 0.198 3.468333333 47.765 3397.923667 3023 17790.10467 0.170666667 23.496 3/8/10 0.581333333 291.4406667 4534.441333 14216.913 4.808333333 PMID18248093 UBERON:feces 211.3473333 27.373 0.061666667 195.5933333 ENVO:human-associated habitat 12.89666667 3.635 40 179.397 0 2.708333333 32.18966667 24.857 4.391333333 0 3.389 0.259333333 CCME 136.4693333 832.637 ctrc 15.68166667 2.923 2.148333333 1644.389333 human gut metagenome 0 1970-01-01 00:00:00 9606 408170 380.4816667 6.700666667 9.238666667 0.421666667 0.163666667 1213.419667 5.849666667 GFIBTIE 12.59233333 75.89033333 Titanium 430.7143333 33.88266667 4.072333333 6.031666667 0 0.259 9.253333333 5.398333333 472.3076667 0.32 9.217 375.002 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 15.53566667 1, tablespoon pyrosequencing 2.162 3.079666667 38.41466667 3.958 291.6603333 13.80266667 V2 CCME 0 0.015 5.490333333 757.2863333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3030.01.S3.405203 ACTCTGAG CTGCTGCCTYCCGTA n 0 0.249 22.0 28.62866667 230.4963333 0.002666667 1335.312 4.360333333 0.152 0.032666667 18.52866667 UBERON:feces 16S rRNA 0.368 23.27 2011 U Penn 254.8736667 1.133666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.286 38.494 11.24066667 3030 0.019 1034.733333 694.5853333 1 2009 1.586 7.174666667 -75.2 6.556666667 107 805.2583333 3798.058333 46.50933333 3.860666667 0.129666667 TCAG 0.199666667 UBERON:feces 0 1.195666667 2.121333333 0 58.25833333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.625 1.760333333 54.21966667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 21.02133333 3.491333333 13.956 12.56966667 GAZ:United States of America 1.152 8.898666667 0 2009 4.563666667 0 1 0.050333333 17.40333333 0.026333333 6.451 4.314666667 cm 2.997 7.909333333 ENVO:human-associated habitat 1101.471667 0.773333333 14.10166667 0.046 0 0.496 0 None years 4.645 14.71833333 0.445666667 PMID:21885721 human gut metagenome 2.292666667 0 human 273.135 13.89966667 3.381 ENVO:feces 0 9.371666667 0 327.798 19.82266667 Fisher Brand Commode Specimen Collection System 10.95766667 0.112333333 0 39.47666667 1067.463333 1.048333333 46.346 93.122 27.28833333 31.412 4.199666667 412.387 1.800333333 10679 60.425 0.492 2.448666667 2009 2691.401333 4.520333333 1.393333333 2010 0.0 3913.120667 18.83133333 male 3125.324 9.144333333 0.131 148.8873333 0.059333333 2.235 47.03666667 2357.261 3030 10013.08 0.264666667 0 4/19/10 0.017 212.7713333 1960.237 9862.779 4.09 PMID18248093 UBERON:feces 197.962 21.01633333 0.003 39.46666667 ENVO:human-associated habitat 15.57133333 1.721333333 22 137.8936667 0 3.333333333 19.452 34.48766667 3.155333333 0 2.223 0.100666667 CCME 85.986 954.0556667 ctrc 9.456333333 2.826 1.491333333 783.541 human gut metagenome 0 1988-01-01 00:00:00 9606 408170 254.606 3.827666667 7.844333333 0.512333333 0.088333333 1225.995667 3.925 GVJ07HB 8.095333333 83.25633333 Titanium 153.4786667 29.60666667 5.016 3.341333333 0 0.215666667 7.909333333 2.676666667 281.7636667 0.453 8.140666667 605.6303333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.356 1, tablespoon pyrosequencing 1.607666667 1.406 39.41133333 6.309 323.638 11.78333333 V2 CCME 0 0.008666667 4.466 578.5116667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3056.01.S2.405149 CACTGTGA CTGCTGCCTYCCGTA n 60.73933333 0.382666667 31.0 59.77333333 155.0686667 0.025 1827.183667 6.862 0.334333333 0.063333333 18.287 UBERON:feces 16S rRNA 0.010333333 23.27 2011 U Penn 213.3663333 1.705 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 2.048 69.46433333 8.846333333 3056 0.083 905.2183333 783.373 1 2009 2.598666667 11.45466667 -75.2 12.603 108 738.314 3904.341333 39.73833333 7.150333333 0.420333333 TCAG 0.180333333 UBERON:feces 0 1.546333333 3.780333333 0 65.053 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.831333333 1.834 44.19833333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 42.77433333 3.533666667 11.369 17.24433333 GAZ:United States of America 1.354 41.217 0 2009 7.506 0.035333333 0 0.078666667 25.08733333 0.035 33.18033333 6.529333333 cm 5.651333333 7.269333333 ENVO:human-associated habitat 1050.763333 0.891 24.58833333 0.016333333 0 0.073 0.000333333 None years 10.481 14.21 0.480666667 PMID:21885721 human gut metagenome 0.189 0 human 350.8266667 22.19066667 21.494 ENVO:feces 0.015 9.195 0 568.4266667 28.95233333 Fisher Brand Commode Specimen Collection System 11.81733333 0.13 0 111.921 931.7406667 1.601666667 79.106 137.2343333 40.842 115.7136667 4.520333333 563.1273333 3.553666667 15302 83.561 0.672333333 4.721666667 2009 3133.225667 6.339 0.107333333 2010 0.0 5867.634667 23.92366667 male 3847.834 90.758 0.162 216.1083333 0.000333333 4.36 41.31833333 3387.483 3056 7869.45 0.296333333 37.94366667 8/30/10 0.022 308.8636667 3326.401667 14173.22933 7.886 PMID18248093 UBERON:feces 183.201 29.673 0.001 35.894 ENVO:human-associated habitat 21.81033333 2.275666667 31 187.2466667 0 2.643666667 27.72766667 35.82566667 5.175 0 2.778666667 0.214333333 CCME 151.6766667 482.869 ctrc 19.456 4.712666667 3.077 861.018 human gut metagenome 0 1979-01-01 00:00:00 9606 408170 332.5396667 8.044333333 10.48133333 0.661 0.295 1316.093 6.732 GVJ07HB 11.863 92.974 Titanium 241.9213333 45.121 5.905666667 7.335333333 0 0.318333333 7.269333333 7.353 349.5853333 0.384333333 12.19166667 705.7276667 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.39533333 1, tablespoon pyrosequencing 2.757333333 3.063666667 54.856 6.622333333 308.7413333 10.84366667 V2 CCME 0 0.01 6.539333333 522.1076667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3053.01.S1.405145 ATGCTAGC CTGCTGCCTYCCGTA n 0 0.218666667 24.0 72.30633333 238.4046667 0.004 1206.627667 4.827666667 0.078666667 0.031333333 11.70133333 UBERON:feces 16S rRNA 0.501666667 23.27 2011 U Penn 244.693 1.345333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 0.781666667 22.40666667 88.96133333 3053 0.026333333 2294.860667 675.5396667 1 2009 1.427333333 4.827333333 -75.2 4.709666667 113 392.736 5511.195667 19.615 4.267 0.079 TCAG 0.192333333 UBERON:feces 0 0.994666667 2.103 0 53.89933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.368 1.502666667 12.90966667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 10.67966667 2.147333333 6.73 9.298333333 GAZ:United States of America 1.095 16.26966667 0 2009 3.396333333 0 1 0.044666667 12.57433333 0.065 13.43566667 2.867666667 LB 2.059 5.368 ENVO:human-associated habitat 4059.054667 0.762 9.338 0.002 0 0.783 0.000666667 None years 4.134 12.38966667 0.709333333 PMID:21885721 human gut metagenome 3.699666667 0 human 188.9946667 69.38933333 30.168 ENVO:feces 0 6.434 0 344.392 15.87866667 Fisher Brand Commode Specimen Collection System 8.728666667 0.017 0.001 38.88233333 2345.796333 0.703666667 181.424 72.80933333 19.48533333 72.999 25.12766667 434.4366667 1.349666667 16414 55.67833333 0.501666667 2.702 2009 2816.433667 2.935 2.830666667 2010 0.0 2306.331 8.705333333 female 3200.797333 50.10166667 0.076 98.984 0.045333333 1.681 35.32333333 2097.502333 3053 1326.634333 2.749333333 0 8/24/10 0.292666667 141.5043333 2299.443 8775.95 2.218 PMID18248093 UBERON:feces 66.794 12.31366667 0.034333333 15.78666667 ENVO:human-associated habitat 11.00966667 2.057666667 24 75.06433333 0 0.928666667 15.93733333 29.27433333 2.489666667 0 1.761 0.019333333 CCME 58.51066667 236.6686667 citric 7.652 2.622333333 1.376 871.023 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 177.2936667 2.479 5.283666667 0.552666667 0.103333333 1219.878333 2.764333333 GVJ07HB 10.12433333 77.05366667 Titanium 293.118 21.446 4.485666667 2.101666667 0 0.187 5.368 1.541333333 272.4076667 0.273333333 6.967333333 480.057 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 10.48766667 1, tablespoon pyrosequencing 1.458 1.474666667 33.62 6.158333333 87.064 8.004 V2 CCME 0 0.041333333 3.138666667 331.757 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4002.01.P1.405132 ATCGATCG CTGCTGCCTYCCGTA n 0 0.247333333 20.0 69.754 184.9353333 0.008333333 1491.161333 5.920666667 0.199666667 0.053333333 15.96566667 UBERON:feces 16S rRNA 0.027333333 23.27 2011 U Penn 199.8696667 0.402666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.329333333 59.657 1.113666667 4002 0.023666667 401.5076667 332.548 None 2009 3.676666667 7.842666667 -75.2 8.117333333 107 733.571 1681.942667 34.46566667 5.264 0.366 TCAG 0.204 UBERON:feces 0 1.174666667 2.614333333 0 67.48233333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 2.215666667 0.964333333 21.992 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 34.901 3.375 9.242666667 30.22566667 GAZ:United States of America 0.484666667 38.73133333 4 2009 5.214 0.013666667 2 0.158 32.73966667 0.009333333 58.96033333 4.594333333 emd 3.972666667 12.477 ENVO:human-associated habitat 176.5366667 0.258 16.919 0.078666667 0 0.676 0 None years 5.804666667 11.148 0.872 PMID:21885721 human gut metagenome 0.100666667 0 human 382.982 0 41.199 ENVO:feces 0 18.058 0 226.2853333 21.46966667 Fisher Brand Commode Specimen Collection System 11.744 0.045666667 0 69.34166667 413.0616667 1.485666667 94.287 123.4536667 36.36566667 148.3326667 0 209.394 2.315666667 5173 49.64766667 0.691 7.765333333 2009 2500.985333 5.417333333 0.120666667 2010 0.0 5773.05 19.37 male 3060.516 143.2993333 0.291666667 248.7426667 0 2.739333333 50.172 3055.438 4002 11558.4 4.114333333 18.30566667 3/10/10 0.030333333 355.4456667 1904.852 12783.952 2.3 PMID18248093 UBERON:feces 200.4316667 22.22366667 0.016666667 7.216666667 ENVO:human-associated habitat 28.76933333 1.203333333 20 166.7043333 0 2.693333333 23.96533333 35.68233333 3.739666667 0 2.471333333 0.116 CCME 103.8156667 502.585 chop 12.70066667 3.406666667 1.640666667 366.9696667 human gut metagenome 0 1990-01-01 00:00:00 9606 408170 367.0163333 4.688 8.038 0.243 0.108 1128.756333 4.724666667 GFIBTIE 6.466 96.43 Titanium 178.8973333 40.41766667 3.256 4.483 0 0.207666667 10.677 4.131666667 242.4673333 0.704 10.82566667 298.126 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 14.003 1, tablespoon pyrosequencing 3.722 1.951 38.79 9.498333333 313.507 19.92866667 V2 CCME 0 0.003666667 4.118 513.7116667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3007.01.P1.405153 AGAGTCTC CTGCTGCCTYCCGTA n 0 0.001666667 29.0 132.8053333 581.7963333 0 1361.777 14.39833333 0.288333333 0.001333333 46.96366667 UBERON:feces 16S rRNA 8.490333333 23.27 2011 U Penn 489.9556667 0.027666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.022 33.968 71.11433333 3007 0 7481.770333 998.342 1 2009 2.385 4.839 -75.2 6.910666667 113 530.65 15004.89533 64.15333333 5.537666667 0.688666667 TCAG 0.64 UBERON:feces 0 2.504 0.162 0.001666667 59.05933333 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.068666667 0.007 1780.231 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 20.50233333 6.939 32.08066667 21.275 GAZ:United States of America 0.004666667 19.547 14.53633333 2009 3.098666667 0 2 0.206333333 19.51866667 0.204666667 17.23366667 3.317 cm 2.448666667 18.70266667 ENVO:human-associated habitat 5166.568 0.003 10.99966667 0.005333333 0 0.119333333 0.064666667 None years 3.371333333 5.028 1.936666667 PMID:21885721 human gut metagenome 38.62133333 0 human 224.4266667 0 10.05666667 ENVO:feces 0 29.28933333 0 230.474 7.472 Fisher Brand Commode Specimen Collection System 15.79366667 0.008333333 0.301666667 0.290333333 8407.492333 0.807666667 298.9426667 65.9 27.94033333 59.753 0 0.073333333 0.908666667 6998 10.01933333 0.046333333 10.84933333 2009 1972.812667 6.041666667 33.901 2009 0.0 1718.141333 18.03633333 female 2326.272 33.00566667 0.148666667 105.118 0.002333333 1.645333333 53.36833333 1655.004333 3007 7462.470667 0 0 12/22/09 0.186 150.2716667 3855.377667 6924.538 12.66033333 PMID18248093 UBERON:feces 104.6953333 12.97733333 0.272666667 364.672 ENVO:human-associated habitat 16.84033333 6.446666667 29 67.85033333 0 1.396333333 17.57033333 33.066 2 0 1.867333333 0 CCME 65.17233333 1904.504333 ctrc 8.877666667 0.240666667 1.122333333 1698.966333 human gut metagenome 0 1980-01-01 00:00:00 9606 408170 177.463 4.337666667 3.709 0.004666667 0.000666667 1072.049 2.706666667 GFIBTIE 0.135333333 84.42966667 Titanium 239.6046667 31.47633333 0.088666667 2.974333333 0 0.000666667 12.16166667 2.801 591.1563333 0.889666667 1.552666667 297.7176667 265.057 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 13.54166667 1, tablespoon pyrosequencing 2.385 1.863333333 9.916333333 9.774333333 23.897 32.649 V2 CCME 0 0.049 3.284666667 513.853 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3059.01.S3.405199 CAGTCTGA CTGCTGCCTYCCGTA n 0 0.173 24.0 174.1253333 497.8876667 0.026666667 1373.522667 8.951 0.429666667 0.025666667 25.34133333 UBERON:feces 16S rRNA 1.015333333 23.27 2011 U Penn 444.5026667 1.190666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.23 27.47533333 586.087 3059 0.070333333 10042.17067 1504.169333 1 2009 1.145 5.162333333 -75.2 7.698333333 113 494.0823333 19843.87767 33.316 8.23 0.642 TCAG 0.592 UBERON:feces 0 1.495666667 1.416 0.001666667 49.684 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 5.739 1.065 684.3156667 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 14.73133333 5.029 16.474 8.497333333 GAZ:United States of America 0.828 33.30366667 0 2009 3.591333333 0.002333333 2 0.068 10.954 2.703333333 30.81066667 3.046 cm 2.434 10.59666667 ENVO:human-associated habitat 12230.46567 0.572666667 11.82433333 0.005 0 1.394666667 0.000333333 None years 4.179666667 14.44733333 0.406333333 PMID:21885721 human gut metagenome 6.385 0 human 221.4466667 8.103666667 37.105 ENVO:feces 0 11.558 0 549.679 13.63466667 Fisher Brand Commode Specimen Collection System 11.42533333 0.002333333 0.000333333 39.34033333 10677.372 0.764333333 593.3753333 66.82266667 18.52233333 124.01 2.573333333 714.4266667 1.453333333 15298 63.41633333 0.304 2.342 2009 2767.677667 3.841666667 4.658 2010 0.0 3303.190333 14.08833333 female 3104.522333 25.182 0.106 99.541 0.105 1.534333333 46.59266667 1779.472333 3059 2869.615 3.289 0.651 8/30/10 0.374 142.336 3945.387333 7445.312333 3.631666667 PMID18248093 UBERON:feces 51.783 11.819 0.058333333 206.0626667 ENVO:human-associated habitat 9.186 4.730666667 24 126.0963333 0 1.37 23.24633333 34.27833333 2.416666667 0 2.751 0.042666667 CCME 72.65033333 665.8933333 ctrc 9.59 1.956 1.046 2393.95 human gut metagenome 0 1986-01-01 00:00:00 9606 408170 196.1053333 3.300333333 4.242 0.414666667 0.219666667 1176.938333 3.032333333 GVJ07HB 17.76466667 71.044 Titanium 713.3206667 22.10533333 2.998 2.856 0 0.147333333 10.59666667 2.032333333 395.22 0.222333333 5.703333333 614.3883333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.416 1, tablespoon pyrosequencing 1.244 1.47 27.421 5.165666667 29.179 15.766 V2 CCME 0 0.198 3.498 473.6816667 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.4000.01.P1.405214 ATATCGCG CTGCTGCCTYCCGTA n 0 0.084333333 7.0 97.912 110.701 0.013666667 825.5556667 4.331333333 0.022333333 0.020333333 14.713 UBERON:feces 16S rRNA 0.029 23.27 2011 U Penn 115.806 3.683333333 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.075333333 45.55633333 11.297 4000 0.040333333 3635.464333 559.2243333 1 2009 1.756 5.484333333 -75.2 5.980333333 104 544.175 7541.544667 28.067 3.247666667 0.139 TCAG 0.144 UBERON:feces 0 1.023666667 3.879333333 0 65.61 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.564666667 0.032333333 891.992 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 31.13266667 2.515 10.35066667 21.915 GAZ:United States of America 0.495666667 48.35633333 0 2009 3.602333333 0.026 5 0.075 24.774 0.297666667 40.24033333 3.152666667 vb 2.808 9.114 ENVO:human-associated habitat 846.8283333 0.056666667 11.92333333 0.002333333 0 0.073666667 0 None years 4.700333333 8.775 1.052333333 PMID:21885721 human gut metagenome 0.413 0 human 350.693 0.326666667 72.67466667 ENVO:feces 0 11.627 0 225.2723333 10.48133333 Fisher Brand Commode Specimen Collection System 8.741333333 0.030333333 2.287 45.20666667 4087.109 0.865333333 92.16 78.27266667 22.59333333 167.9856667 0.096666667 149.7063333 1.663 5048 31.40033333 0.505666667 4.767666667 2009 1355.028333 1.846 0.176 2010 0.0 3481.3 17.18666667 male 1850.898667 164.5473333 0.121666667 219.9443333 0 1.997 58.37266667 2379.723 4000 4781.428667 0.144333333 18.653 3/11/10 0.042333333 314.3363333 1665.164333 9956.761333 3.285666667 PMID18248093 UBERON:feces 144.8996667 14.70366667 0.006666667 1.635333333 ENVO:human-associated habitat 22.69933333 1.475666667 7 104.3276667 0 1.658 14.67233333 29.05766667 2.350333333 0 1.524333333 0.009666667 CCME 73.269 570.4133333 chop 8.536333333 4.503333333 0.609 899.817 human gut metagenome 0 2003-01-01 00:00:00 9606 408170 335.489 3.905333333 4.427666667 0.528666667 0.121666667 492.942 3.474666667 GFIBTIE 3.355666667 93.766 Titanium 185.1173333 23.454 1.905 3.525 0 0.071333333 9.114 3.165666667 201.2733333 0.685666667 6.179333333 218.632 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 12.41533333 1, tablespoon pyrosequencing 1.836333333 1.828666667 23.67833333 9.184333333 251.9026667 13.59166667 V2 CCME 0 0.007333333 2.932333333 367.7083333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3070.01.S1.405144 CGATGCTA CTGCTGCCTYCCGTA n 0 0.146333333 37.0 149.6603333 104.358 0.019666667 1059.505 4.138 0.012333333 0.021333333 13.157 UBERON:feces 16S rRNA 0.300333333 23.27 2011 U Penn 208.86 1.735666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.006333333 47.489 260.9276667 3070 0.039666667 4348.636 1213.299333 1 2009 1.835333333 5.426666667 -75.2 5.741333333 108 862.25 11020.18 23.06766667 4.362 0.139666667 TCAG 0.111666667 UBERON:feces 0 0.821666667 3.815333333 0 66.73266667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 4.804333333 0.728333333 1089.542 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 32.67233333 2.56 8.77 17.03166667 GAZ:United States of America 0.705666667 25.41833333 0 2009 3.613666667 0.023333333 0 0.051666667 23.02866667 0.004333333 19.68833333 3.072666667 cm 2.749666667 11.31866667 ENVO:human-associated habitat 1042.366 0.454 11.534 0.001333333 0 0.129333333 0 None years 4.636 11.04766667 0.781333333 PMID:21885721 human gut metagenome 1.133 0 human 282.8793333 0.435666667 69.42766667 ENVO:feces 0.001 13.27833333 0 252.4783333 14.203 Fisher Brand Commode Specimen Collection System 11.32366667 0.071666667 2.744333333 48.07233333 5023.874 0.889 99.63266667 86.62566667 26.417 130.0356667 0.211 270.79 1.633 7820 43.288 0.703 2.948 2009 2496.642 4.444666667 0.86 2010 0.0 2815.592333 22.91633333 male 2921.627 93.04866667 0.102 180.2176667 0.088 1.943 49.86033333 2187.632333 3070 583.2133333 0.036666667 15.27366667 9/16/10 0.238666667 257.625 2164.911333 9153.052667 2.356666667 PMID18248093 UBERON:feces 123.7246667 13.80966667 0.019333333 0 ENVO:human-associated habitat 20.911 1.793666667 37 91.94166667 0 1.981 15.958 33.491 2.426666667 0 2.307666667 0.002666667 CCME 71.126 389.0406667 ctrc 9.489666667 4.713 0.890333333 1631.955667 human gut metagenome 0 1973-01-01 00:00:00 9606 408170 269.7226667 3.689 4.550333333 0.460333333 0.122 954.845 3.411666667 GVJ07HB 13.01533333 95.40133333 Titanium 86.223 27.552 3.010333333 3.276666667 0 0.125666667 11.31866667 2.892333333 244.0206667 0.569333333 6.904666667 794.6433333 0 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 16.371 1, tablespoon pyrosequencing 1.918666667 2.655666667 29.45366667 8.506666667 384.2933333 16.88933333 V2 CCME 0 0.013333333 2.901 593.1533333 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes
C.3016.01.P1.405202 AGTCAGTC CTGCTGCCTYCCGTA n 70.49633333 0.192666667 24.0 36.86733333 224.5123333 0.019333333 1762.943 4.103666667 0.212666667 0.029333333 21.91066667 UBERON:feces 16S rRNA 0.526666667 23.27 2011 U Penn 257.748 2.492666667 Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes PMID18248093 1.482 51.51933333 140.862 3016 0.074666667 1452.387333 513.6703333 1 2009 2.799333333 8.849666667 -75.2 9.890666667 113 491.5353333 4069.440333 42.58266667 5.202666667 0.918333333 TCAG 0.358666667 UBERON:feces 0 2.399666667 2.304666667 0.004 56.02366667 FWD:AGAGTTTGATCCTGGCTCAG REV:CTGCTGCCTYCCGTA 1.330666667 1.073 352.5913333 initial denaturation:95C_5min; initial denaturation:95c_0.5min; annealing:56C_0.5min; elongation:72C_1.5min; final elongation:72C_8min; 25 cycles 28.387 5.156333333 17.79833333 18.79866667 GAZ:United States of America 0.879333333 19.803 0 2009 5.966333333 0.035333333 3 0.48 31.03833333 0.183 18.09233333 5.257 cm 4.389 15.33233333 ENVO:human-associated habitat 725.7426667 0.492666667 19.22333333 0.146333333 0 0.474666667 0.003666667 None years 7.665 13.98633333 0.807 PMID:21885721 human gut metagenome 3.474666667 5.963 human 220.052 0 18.21833333 ENVO:feces 0 17.72966667 0 351.5836667 20.43533333 Fisher Brand Commode Specimen Collection System 18.07233333 0.079333333 0.002666667 73.84133333 1699.115333 1.387666667 103.461 131.0113333 46.88466667 62.19266667 0 380.2303333 2.550666667 16034 59.38733333 0.396666667 3.679 2009 5073.614 2.162666667 2.206666667 2010 0.0 5867.442 13.695 female 5541.643 11.984 0.387 110.0543333 0.030333333 3.245333333 35.59666667 2471.587667 3016 3537.973333 0.202 19.40033333 2/4/10 0.013 157.2863333 2643.944667 10341.122 1.336333333 PMID18248093 UBERON:feces 118.025 24.36866667 0.040666667 44.21366667 ENVO:human-associated habitat 27.51333333 3.53 24 148.375 0 1.680333333 25.98566667 45.82533333 4.139666667 0 1.694666667 0.083333333 CCME 116.4243333 1107.946667 ctrc 13.047 2.808333333 2.211666667 655.2633333 human gut metagenome 0 1986-06-01 00:00:00 9606 408170 197.4233333 7.060333333 7.754333333 0.593 0.265333333 1294.603667 5.411333333 GFIBTIE 4.268 80.06533333 Titanium 116.5506667 51.53966667 4.006333333 5.169 0 0.162666667 15.33233333 5.107333333 472.789 1.202333333 8.057666667 372.0773333 9.45 1011 We used diet inventories and 16S rDNA sequencing to characterize fecal samples from 98 individuals. 18.51366667 1, tablespoon pyrosequencing 2.928666667 1.645666667 39.97566667 10.85533333 137.6523333 22.881 V2 CCME 0 4.304 5.224333333 395.4 39.95 U Penn Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes