object-translate

telatin · May 31, 2024 · 32e31cc · 32e31cc
1 parent 50f3e7d
commit 32e31cc
Showing 1 changed file with 45 additions and 6 deletions.
diff --git a/first-steps/05-object.ipynb b/first-steps/05-object.ipynb
@@ -15,7 +15,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": 3,
+   "execution_count": 21,
    "metadata": {},
    "outputs": [
     {
@@ -43,7 +43,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": 4,
+   "execution_count": 22,
    "metadata": {},
    "outputs": [],
    "source": [
@@ -75,7 +75,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": 6,
+   "execution_count": 23,
    "metadata": {},
    "outputs": [
     {
@@ -107,7 +107,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": 8,
+   "execution_count": 24,
    "metadata": {},
    "outputs": [
     {
@@ -142,7 +142,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": 9,
+   "execution_count": 25,
    "metadata": {},
    "outputs": [
     {
@@ -209,7 +209,7 @@
   },
   {
    "cell_type": "code",
-   "execution_count": null,
+   "execution_count": 26,
    "metadata": {},
    "outputs": [],
    "source": [
@@ -263,6 +263,45 @@
     "                protein.append(self.codon_table.get(codon, 'X'))  # 'X' for unknown codons\n",
     "        return ''.join(protein)"
    ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "here we added a custom method **translate** and the equality comparison. Let's try again to compare the sequences:"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 27,
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "Sequences are the same, and the protein sequence is  DARWIN*\n"
+     ]
+    }
+   ],
+   "source": [
+    "dna1 = DNASequence(\"GATGCGcgctggattaactaa\", \"SampleSeq\", \"Example description\")\n",
+    "dna2 = DNASequence(\"gatgcgcgctggattaactaa\", \"SampleSeq\")\n",
+    "\n",
+    "if (dna1 == dna2):\n",
+    "    print(\"Sequences are the same, and the protein sequence is \", dna1.translate())\n",
+    "\n",
+    " "
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "## Try yourself\n",
+    "\n",
+    "now add a method to return the gc content"
+   ]
   }
  ],
  "metadata": {