Skip to content

Commit

Permalink
Update example and test files for R and Python
Browse files Browse the repository at this point in the history
  • Loading branch information
bussec committed Feb 21, 2024
1 parent 07bbd41 commit 2e0f64e
Show file tree
Hide file tree
Showing 18 changed files with 2,360 additions and 981 deletions.
182 changes: 128 additions & 54 deletions lang/R/inst/extdata/germline-example.json
Original file line number Diff line number Diff line change
@@ -1,29 +1,75 @@
{
"GermlineSet": [{
"germline_set_id": "OGRDB:G00007",
"author": "William Lees",
"lab_name": "",
"lab_address": "Birkbeck College, University of London, Malet Street, London",
"acknowledgements": [],
"acknowledgements": [
{
"contributor_id": "1",
"name": "William Lees",
"orcid_id": {
"id": "ORCID:0000-0001-9834-6840",
"label": "William Lees"
},
"affiliation": {
"id": "ROR:02mb95055",
"label": "Birkbeck, University of London"
},
"affiliation_department":"",
"contributions": [
{
"role": "investigation",
"degree": null
},
{
"role": "data curation",
"degree": null
}
]
}
],
"release_version": 1,
"release_description": "",
"release_date": "2021-11-24",
"germline_set_name": "CAST IGH",
"germline_set_ref": "OGRDB:G00007.1",
"pub_ids": "",
"species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
"pub_ids": [""],
"species": {
"id": "NCBITAXON:10090",
"label": "Mus musculus"
},
"species_subgroup": "CAST_EiJ",
"species_subgroup_type": "strain",
"locus": "IGH",
"allele_descriptions": [
{
"allele_description_id": "OGRDB:A00301",
"allele_description_ref": "OGRDB:Mouse_IGH:IGHV-2DBF",
"maintainer": "William Lees",
"acknowledgements": [],
"lab_address": "Birkbeck College, University of London, Malet Street, London",
"acknowledgements": [
{
"contributor_id": "1",
"name": "William Lees",
"orcid_id": {
"id": "ORCID:0000-0001-9834-6840",
"label": "William Lees"
},
"affiliation": {
"id": "ROR:02mb95055",
"label": "Birkbeck, University of London"
},
"affiliation_department":"",
"contributions": [
{
"role": "investigation",
"degree": null
},
{
"role": "data curation",
"degree": null
}
]
}
],
"release_version": 1,
"release_date": "24-Nov-2021",
"release_date": "2021-11-24",
"release_description": "First release",
"label": "IGHV-2DBF",
"sequence": "GAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTGGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAA",
Expand All @@ -36,7 +82,10 @@
"sequence_type": "V",
"functional": true,
"inference_type": "rearranged_only",
"species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
"species": {
"id": "NCBITAXON:10090",
"label": "Mus musculus"
},
"species_subgroup": "CAST_EiJ",
"species_subgroup_type": "strain",
"status": "active",
Expand Down Expand Up @@ -70,7 +119,7 @@
"fwr3_start": 161,
"fwr3_end": 294,
"cdr3_start": 295,
"alignment": [
"alignment_labels": [
"1",
"2",
"3",
Expand Down Expand Up @@ -187,11 +236,33 @@
{
"allele_description_id": "OGRDB:A00314",
"allele_description_ref": "OGRDB:Mouse_IGH:IGHV-2ETO",
"maintainer": "William Lees",
"acknowledgements": [],
"lab_address": "Birkbeck College, University of London, Malet Street, London",
"acknowledgements": [
{
"contributor_id": "1",
"name": "William Lees",
"orcid_id": {
"id": "ORCID:0000-0001-9834-6840",
"label": "William Lees"
},
"affiliation": {
"id": "ROR:02mb95055",
"label": "Birkbeck, University of London"
},
"affiliation_department":"",
"contributions": [
{
"role": "investigation",
"degree": null
},
{
"role": "data curation",
"degree": null
}
]
}
],
"release_version": 1,
"release_date": "24-Nov-2021",
"release_date": "2021-11-24",
"release_description": "First release",
"label": "IGHV-2ETO",
"sequence": "CAAGTTACTCTAAAAGAGTCTGGCCCTGGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTACTAATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTC",
Expand All @@ -204,7 +275,10 @@
"sequence_type": "V",
"functional": true,
"inference_type": "rearranged_only",
"species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
"species": {
"id": "NCBITAXON:10090",
"label": "Mus musculus"
},
"species_subgroup": "CAST_EiJ",
"species_subgroup_type": "strain",
"status": "active",
Expand Down Expand Up @@ -238,7 +312,7 @@
"fwr3_start": 161,
"fwr3_end": 294,
"cdr3_start": 295,
"alignment": [
"alignment_labels": [
"1",
"2",
"3",
Expand Down Expand Up @@ -356,40 +430,40 @@
"curation": null
}],

"GenotypeSet": [{
"receptor_genotype_set_id": "1",
"genotype_class_list": [
{
"receptor_genotype_id": "1",
"locus": "IGH",
"documented_alleles": [
{
"label": "IGHV1-69*01",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 1
},
{
"label": "IGHV1-69*02",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 2
}
],
"undocumented_alleles": [
{
"allele_name": "IGHD3-1*01_S1234",
"sequence": "agtagtagtagt",
"phasing": 1
}
],
"deleted_genes": [
{
"label": "IGHV3-30-3",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 1
}
],
"inference_process": "repertoire_sequencing"
}
]
}]
"GenotypeSet": [{
"receptor_genotype_set_id": "1",
"genotype_class_list": [
{
"receptor_genotype_id": "1",
"locus": "IGH",
"documented_alleles": [
{
"label": "IGHV1-69*01",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 1
},
{
"label": "IGHV1-69*02",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 2
}
],
"undocumented_alleles": [
{
"allele_name": "IGHD3-1*01_S1234",
"sequence": "agtagtagtagt",
"phasing": 1
}
],
"deleted_genes": [
{
"label": "IGHV3-30-3",
"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
"phasing": 1
}
],
"inference_process": "repertoire_sequencing"
}
]
}]
}
Loading

0 comments on commit 2e0f64e

Please sign in to comment.