Update example and test files for R and Python

airr-community · Feb 26, 2024 · 47f9a6e · 47f9a6e
1 parent 1e563b4
commit 47f9a6e
Show file tree

Hide file tree

Showing 22 changed files with 2,364 additions and 997 deletions.
diff --git a/lang/R/inst/extdata/airr-schema.yaml b/lang/R/inst/extdata/airr-schema.yaml
@@ -1571,10 +1571,7 @@ Study:
         - study_type
         - inclusion_exclusion_criteria
         - grants
-        - collected_by
-        - lab_name
-        - lab_address
-        - submitted_by
+        - contributors
         - pub_ids
         - keywords_study
     properties:

diff --git a/lang/R/inst/extdata/germline-example.json b/lang/R/inst/extdata/germline-example.json
@@ -1,29 +1,75 @@
 {
     "GermlineSet": [{
         "germline_set_id": "OGRDB:G00007",
-        "author": "William Lees",
-        "lab_name": "",
-        "lab_address": "Birkbeck College, University of London, Malet Street, London",
-        "acknowledgements": [],
+        "acknowledgements": [
+            {
+                "contributor_id": "1",
+                "name": "William Lees",
+                "orcid_id": {
+                    "id": "ORCID:0000-0001-9834-6840",
+                    "label": "William Lees"
+                },
+                "affiliation": {
+                    "id": "ROR:02mb95055",
+                    "label": "Birkbeck, University of London"
+                },
+                "affiliation_department":"",
+                "contributions": [
+                    {
+                        "role": "investigation",
+                        "degree": null
+                    },
+                    {
+                        "role": "data curation",
+                        "degree": null
+                    }
+                ]
+            }
+        ],
         "release_version": 1,
         "release_description": "",
         "release_date": "2021-11-24",
         "germline_set_name": "CAST IGH",
         "germline_set_ref": "OGRDB:G00007.1",
-        "pub_ids": "",
-        "species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
+        "pub_ids": [""],
+        "species": {
+            "id": "NCBITAXON:10090",
+            "label": "Mus musculus"
+        },
         "species_subgroup": "CAST_EiJ",
         "species_subgroup_type": "strain",
         "locus": "IGH",
         "allele_descriptions": [
             {
                 "allele_description_id": "OGRDB:A00301",
                 "allele_description_ref": "OGRDB:Mouse_IGH:IGHV-2DBF",
-                "maintainer": "William Lees",
-                "acknowledgements": [],
-                "lab_address": "Birkbeck College, University of London, Malet Street, London",
+                "acknowledgements":  [
+                    {
+                        "contributor_id": "1",
+                        "name": "William Lees",
+                        "orcid_id": {
+                            "id": "ORCID:0000-0001-9834-6840",
+                            "label": "William Lees"
+                        },
+                        "affiliation": {
+                            "id": "ROR:02mb95055",
+                            "label": "Birkbeck, University of London"
+                        },
+                        "affiliation_department":"",
+                        "contributions": [
+                            {
+                                "role": "investigation",
+                                "degree": null
+                            },
+                            {
+                                "role": "data curation",
+                                "degree": null
+                            }
+                        ]
+                    }
+                ],
                 "release_version": 1,
-                "release_date": "24-Nov-2021",
+                "release_date": "2021-11-24",
                 "release_description": "First release",
                 "label": "IGHV-2DBF",
                 "sequence": "GAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTGGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAA",
@@ -36,7 +82,10 @@
                 "sequence_type": "V",
                 "functional": true,
                 "inference_type": "rearranged_only",
-                "species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
+                "species": {
+                    "id": "NCBITAXON:10090",
+                    "label": "Mus musculus"
+                },
                 "species_subgroup": "CAST_EiJ",
                 "species_subgroup_type": "strain",
                 "status": "active",
@@ -70,7 +119,7 @@
                         "fwr3_start": 161,
                         "fwr3_end": 294,
                         "cdr3_start": 295,
-                        "alignment": [
+                        "alignment_labels": [
                             "1",
                             "2",
                             "3",
@@ -187,11 +236,33 @@
             {
                 "allele_description_id": "OGRDB:A00314",
                 "allele_description_ref": "OGRDB:Mouse_IGH:IGHV-2ETO",
-                "maintainer": "William Lees",
-                "acknowledgements": [],
-                "lab_address": "Birkbeck College, University of London, Malet Street, London",
+                "acknowledgements":  [
+                    {
+                        "contributor_id": "1",
+                        "name": "William Lees",
+                        "orcid_id": {
+                            "id": "ORCID:0000-0001-9834-6840",
+                            "label": "William Lees"
+                        },
+                        "affiliation": {
+                            "id": "ROR:02mb95055",
+                            "label": "Birkbeck, University of London"
+                        },
+                        "affiliation_department":"",
+                        "contributions": [
+                            {
+                                "role": "investigation",
+                                "degree": null
+                            },
+                            {
+                                "role": "data curation",
+                                "degree": null
+                            }
+                        ]
+                    }
+                ],
                 "release_version": 1,
-                "release_date": "24-Nov-2021",
+                "release_date": "2021-11-24",
                 "release_description": "First release",
                 "label": "IGHV-2ETO",
                 "sequence": "CAAGTTACTCTAAAAGAGTCTGGCCCTGGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTACTAATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTC",
@@ -204,7 +275,10 @@
                 "sequence_type": "V",
                 "functional": true,
                 "inference_type": "rearranged_only",
-                "species": { "id": "NCBITAXON:10090", "label": "Mus musculus" },
+                "species": {
+                    "id": "NCBITAXON:10090",
+                    "label": "Mus musculus"
+                },
                 "species_subgroup": "CAST_EiJ",
                 "species_subgroup_type": "strain",
                 "status": "active",
@@ -238,7 +312,7 @@
                         "fwr3_start": 161,
                         "fwr3_end": 294,
                         "cdr3_start": 295,
-                        "alignment": [
+                        "alignment_labels": [
                             "1",
                             "2",
                             "3",
@@ -356,40 +430,40 @@
         "curation": null
     }],
 
-	"GenotypeSet": [{
-		"receptor_genotype_set_id": "1",
-		"genotype_class_list": [
-			{
-				"receptor_genotype_id": "1",
-				"locus": "IGH",
-				"documented_alleles": [
-					{
-						"label": "IGHV1-69*01",
-						"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
-						"phasing": 1
-					},
-					{
-						"label": "IGHV1-69*02",
-						"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
-						"phasing": 2
-					}
-				],
-				"undocumented_alleles": [
-					{
-						"allele_name": "IGHD3-1*01_S1234",
-						"sequence": "agtagtagtagt",
-						"phasing": 1
-					}
-				],
-				"deleted_genes": [
-					{
-						"label": "IGHV3-30-3",
-						"germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
-						"phasing": 1
-					}
-				],
-				"inference_process": "repertoire_sequencing"
-			}
-		]
-	}]
+    "GenotypeSet": [{
+        "receptor_genotype_set_id": "1",
+        "genotype_class_list": [
+            {
+                "receptor_genotype_id": "1",
+                "locus": "IGH",
+                "documented_alleles": [
+                    {
+                        "label": "IGHV1-69*01",
+                        "germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
+                        "phasing": 1
+                    },
+                    {
+                        "label": "IGHV1-69*02",
+                        "germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
+                        "phasing": 2
+                    }
+                ],
+                "undocumented_alleles": [
+                    {
+                        "allele_name": "IGHD3-1*01_S1234",
+                        "sequence": "agtagtagtagt",
+                        "phasing": 1
+                    }
+                ],
+                "deleted_genes": [
+                    {
+                        "label": "IGHV3-30-3",
+                        "germline_set_ref": "IMGT:Homo sapiens:2022.1.31",
+                        "phasing": 1
+                    }
+                ],
+                "inference_process": "repertoire_sequencing"
+            }
+        ]
+    }]
 }