Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 #432

gxydevbot · 2024-05-27T13:46:31Z

Hello! This is an automated update of the following workflow: workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1

The workflow release number has been updated from 0.1.5 to 0.1.6.

gxydevbot · 2024-09-23T14:48:29Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-09-23T15:16:17Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ se-wgs-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Single End Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream", "-no-utr"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 3: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -sf '/tmp/tmp3lbo38ju/files/a/f/c/dataset_afcee5b7-a176-4a8d-9ac9-313c1fd0c102.dat' 'SRR11605118.fastq' &&     fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11605118.fastq'   -i 'SRR11605118.fastq' -o first.fastq                                                 &&  mv first.fastq '/tmp/tmp3lbo38ju/job_working_directory/000/3/outputs/dataset_a8d47fb6-cf63-457a-a79f-dee2050a0f9c.dat'

Exit Code:

```
255
```

Standard Error:

Expected '+', got �B���
>O��g��r
C9���f��h�UV���P�T��){,����ؑ�p�6
����:��mR%�Y?[gjk^�叐��Mf��+��V-T���h������:��3��,
]�kY �/�����m7G�J
"�Hy�'����K��O�En
ERROR: '+' expected

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 4: toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 1, "own_file": {"values": [{"id": 1, "src": "hda"}]}, "source": "history"}`
rg	`{"__current_case__": 2, "rg_selector": "set_id_auto"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comments	`[]`
dbkey	`"?"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
inputFile	__identifier__
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 6: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 7, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}]`
saveLog	`"false"`
title	`""`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 8: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7dbe08f679be11efb0af2d237307951c"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmp3lbo38ju/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - d52bafc72fd3d302
- history_state
  - error
- invocation_id
  - d52bafc72fd3d302
- invocation_state
  - scheduled
- workflow_id
  - d52bafc72fd3d302

gxydevbot · 2024-09-24T14:25:48Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-09-24T14:33:37Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ se-wgs-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Single End Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream", "-no-utr"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 3: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -sf '/tmp/tmpttc56a5y/files/a/b/7/dataset_ab7495b6-aec1-476f-a9b6-b640a490e374.dat' 'SRR11605118.fastq' &&     fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11605118.fastq'   -i 'SRR11605118.fastq' -o first.fastq                                                 &&  mv first.fastq '/tmp/tmpttc56a5y/job_working_directory/000/3/outputs/dataset_cdfeb723-86ab-46c3-a7c5-02e8c895e5b2.dat'

Exit Code:

```
255
```

Standard Error:

Expected '+', got �B���
>O��g��r
C9���f��h�UV���P�T��){,����ؑ�p�6
����:��mR%�Y?[gjk^�叐��Mf��+��V-T���h������:��3��,
]�kY �/�����m7G�J
"�Hy�'����K��O�En
ERROR: '+' expected

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 4: toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 1, "own_file": {"values": [{"id": 1, "src": "hda"}]}, "source": "history"}`
rg	`{"__current_case__": 2, "rg_selector": "set_id_auto"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comments	`[]`
dbkey	`"?"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
inputFile	__identifier__
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 6: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 7, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}]`
saveLog	`"false"`
title	`""`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 8: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"c6d337fa7a8111efae09a1b535a11c9c"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmpttc56a5y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - 35ad36521520aef7
- history_state
  - error
- invocation_id
  - 35ad36521520aef7
- invocation_state
  - scheduled
- workflow_id
  - 35ad36521520aef7

gxydevbot · 2024-10-07T05:23:37Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-10-07T05:30:31Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ se-wgs-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Single End Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream", "-no-utr"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 3: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -sf '/tmp/tmppcmymovv/files/4/d/6/dataset_4d6dfc58-4c5b-4ea9-a959-73e282c01143.dat' 'SRR11605118.fastq' &&     fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11605118.fastq'   -i 'SRR11605118.fastq' -o first.fastq                                                 &&  mv first.fastq '/tmp/tmppcmymovv/job_working_directory/000/3/outputs/dataset_65e29b37-257a-43c6-876c-4b0e5b067099.dat'

Exit Code:

```
255
```

Standard Error:

Expected '+', got �B���
>O��g��r
C9���f��h�UV���P�T��){,����ؑ�p�6
����:��mR%�Y?[gjk^�叐��Mf��+��V-T���h������:��3��,
]�kY �/�����m7G�J
"�Hy�'����K��O�En
ERROR: '+' expected

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 4: toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 1, "own_file": {"values": [{"id": 1, "src": "hda"}]}, "source": "history"}`
rg	`{"__current_case__": 2, "rg_selector": "set_id_auto"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comments	`[]`
dbkey	`"?"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
inputFile	__identifier__
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 6: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 7, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}]`
saveLog	`"false"`
title	`""`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 8: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"118499fc846d11ef927f2d34673a49fb"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmppcmymovv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - d4b7ba461c0d7c82
- history_state
  - error
- invocation_id
  - d4b7ba461c0d7c82
- invocation_state
  - scheduled
- workflow_id
  - d4b7ba461c0d7c82

gxydevbot · 2024-10-21T05:14:19Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-10-21T05:25:50Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ se-wgs-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Single End Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream", "-no-utr"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 3: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmp4be7xmbm/files/b/a/d/dataset_bad3a418-9bb4-47a6-8f44-1fb8b75a8f9c.dat' 'SRR11605118.fastqsanger.gz' &&   cp '/tmp/tmp4be7xmbm/job_working_directory/000/3/configs/tmporlz8n7u' galaxy.json &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11605118.fastqsanger.gz'   -i 'SRR11605118.fastqsanger.gz'   -o first.fastqsanger.gz                                               && mv first.fastqsanger.gz '/tmp/tmp4be7xmbm/job_working_directory/000/3/outputs/dataset_303fd405-4c95-4d37-804b-90496bb6e6fc.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
GGGTCGCCAATGTACACATAGTGCTTAGCACGTAATCTGGCATTGACAACACTCAAATCA

Read1 before filtering:
total reads: 192194
total bases: 18547465
Q20 bases: 18547465(100%)
Q30 bases: 18547465(100%)

Read1 after filtering:
total reads: 192051
total bases: 18528769
Q20 bases: 18528769(100%)
Q30 bases: 18528769(100%)

Filtering result:
reads passed filter: 192051
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 143
reads with adapter trimmed: 353
bases trimmed due to adapters: 16937

Duplication rate (may be overestimated since this is SE data): 67.063%

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR11605118.fastqsanger.gz -i SRR11605118.fastqsanger.gz -o first.fastqsanger.gz 
fastp v0.23.4, time used: 4 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 4: toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail; bowtie2-build --threads ${GALAXY_SLOTS:-4} '/tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat' genome && ln -s -f '/tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat' genome.fa &&   ln -f -s '/tmp/tmp4be7xmbm/files/3/0/3/dataset_303fd405-4c95-4d37-804b-90496bb6e6fc.dat' input_f.fastq.gz &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x 'genome'   -U 'input_f.fastq.gz'                         --rg-id "SRR11605118"             --very-sensitive   2> >(tee '/tmp/tmp4be7xmbm/job_working_directory/000/4/outputs/dataset_f3a3cc8a-dcf5-49f1-bfa8-4bc7cc0d77d2.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmp4be7xmbm/job_working_directory/000/4/outputs/dataset_4c59b9dc-9950-4b52-a9f0-7f726fa4d918.dat'

Exit Code:

```
0
```

Standard Error:

Building a SMALL index
Renaming genome.3.bt2.tmp to genome.3.bt2
Renaming genome.4.bt2.tmp to genome.4.bt2
Renaming genome.1.bt2.tmp to genome.1.bt2
Renaming genome.2.bt2.tmp to genome.2.bt2
Renaming genome.rev.1.bt2.tmp to genome.rev.1.bt2
Renaming genome.rev.2.bt2.tmp to genome.rev.2.bt2
192051 reads; of these:
  192051 (100.00%) were unpaired; of these:
    568 (0.30%) aligned 0 times
    191483 (99.70%) aligned exactly 1 time
    0 (0.00%) aligned >1 times
99.70% overall alignment rate

Standard Output:

Settings:
  Output files: "genome.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  /tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 7475
Using parameters --bmax 5607 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 5607 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
  Building sPrime
  Building sPrimeOrder
  V-Sorting samples
  V-Sorting samples time: 00:00:00
  Allocating rank array
  Ranking v-sort output
  Ranking v-sort output time: 00:00:00
  Invoking Larsson-Sadakane on ranks
  Invoking Larsson-Sadakane on ranks time: 00:00:00
  Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
  (Using difference cover)
  Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Splitting and merging
  Splitting and merging time: 00:00:00
Avg bucket size: 3737 (target: 5606)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 8
  Reserving size (5607) for bucket 1
  Calculating Z arrays for bucket 1
  Entering block accumulator loop for bucket 1:
  bucket 1: 10%
  bucket 1: 20%
  bucket 1: 30%
  bucket 1: 40%
  bucket 1: 50%
  bucket 1: 60%
  bucket 1: 70%
  bucket 1: 80%
  bucket 1: 90%
  bucket 1: 100%
  Sorting block of length 4574 for bucket 1
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 4575 for bucket 1
Getting block 2 of 8
  Reserving size (5607) for bucket 2
  Calculating Z arrays for bucket 2
  Entering block accumulator loop for bucket 2:
  bucket 2: 10%
  bucket 2: 20%
  bucket 2: 30%
  bucket 2: 40%
  bucket 2: 50%
  bucket 2: 60%
  bucket 2: 70%
  bucket 2: 80%
  bucket 2: 90%
  bucket 2: 100%
  Sorting block of length 2668 for bucket 2
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 2669 for bucket 2
Getting block 3 of 8
  Reserving size (5607) for bucket 3
  Calculating Z arrays for bucket 3
  Entering block accumulator loop for bucket 3:
  bucket 3: 10%
  bucket 3: 20%
  bucket 3: 30%
  bucket 3: 40%
  bucket 3: 50%
  bucket 3: 60%
  bucket 3: 70%
  bucket 3: 80%
  bucket 3: 90%
  bucket 3: 100%
  Sorting block of length 3483 for bucket 3
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 3484 for bucket 3
Getting block 4 of 8
  Reserving size (5607) for bucket 4
  Calculating Z arrays for bucket 4
  Entering block accumulator loop for bucket 4:
  bucket 4: 10%
  bucket 4: 20%
  bucket 4: 30%
  bucket 4: 40%
  bucket 4: 50%
  bucket 4: 60%
  bucket 4: 70%
  bucket 4: 80%
  bucket 4: 90%
  bucket 4: 100%
  Sorting block of length 4420 for bucket 4
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 4421 for bucket 4
Getting block 5 of 8
  Reserving size (5607) for bucket 5
  Calculating Z arrays for bucket 5
  Entering block accumulator loop for bucket 5:
  bucket 5: 10%
  bucket 5: 20%
  bucket 5: 30%
  bucket 5: 40%
  bucket 5: 50%
  bucket 5: 60%
  bucket 5: 70%
  bucket 5: 80%
  bucket 5: 90%
  bucket 5: 100%
  Sorting block of length 4901 for bucket 5
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 4902 for bucket 5
Getting block 6 of 8
  Reserving size (5607) for bucket 6
  Calculating Z arrays for bucket 6
  Entering block accumulator loop for bucket 6:
  bucket 6: 10%
  bucket 6: 20%
  bucket 6: 30%
  bucket 6: 40%
  bucket 6: 50%
  bucket 6: 60%
  bucket 6: 70%
  bucket 6: 80%
  bucket 6: 90%
  bucket 6: 100%
  Sorting block of length 3813 for bucket 6
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 3814 for bucket 6
Getting block 7 of 8
  Reserving size (5607) for bucket 7
  Calculating Z arrays for bucket 7
  Entering block accumulator loop for bucket 7:
  bucket 7: 10%
  bucket 7: 20%
  bucket 7: 30%
  bucket 7: 40%
  bucket 7: 50%
  bucket 7: 60%
  bucket 7: 70%
  bucket 7: 80%
  bucket 7: 90%
  bucket 7: 100%
  Sorting block of length 2667 for bucket 7
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 2668 for bucket 7
Getting block 8 of 8
  Reserving size (5607) for bucket 8
  Calculating Z arrays for bucket 8
  Entering block accumulator loop for bucket 8:
  bucket 8: 10%
  bucket 8: 20%
  bucket 8: 30%
  bucket 8: 40%
  bucket 8: 50%
  bucket 8: 60%
  bucket 8: 70%
  bucket 8: 80%
  bucket 8: 90%
  bucket 8: 100%
  Sorting block of length 3370 for bucket 8
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 3371 for bucket 8
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 8954
fchr[G]: 14446
fchr[T]: 20309
fchr[$]: 29903
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 4204461 bytes to primary EBWT file: genome.1.bt2.tmp
Wrote 7480 bytes to secondary EBWT file: genome.2.bt2.tmp
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
    len: 29903
    bwtLen: 29904
    sz: 7476
    bwtSz: 7476
    lineRate: 6
    offRate: 4
    offMask: 0xfffffff0
    ftabChars: 10
    eftabLen: 20
    eftabSz: 80
    ftabLen: 1048577
    ftabSz: 4194308
    offsLen: 1869
    offsSz: 7476
    lineSz: 64
    sideSz: 64
    sideBwtSz: 48
    sideBwtLen: 192
    numSides: 156
    numLines: 156
    ebwtTotLen: 9984
    ebwtTotSz: 9984
    color: 0
    reverse: 0
Total time for call to driver() for forward index: 00:00:00
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
  Time to reverse reference sequence: 00:00:00
bmax according to bmaxDivN setting: 7475
Using parameters --bmax 5607 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 5607 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
  Building sPrime
  Building sPrimeOrder
  V-Sorting samples
  V-Sorting samples time: 00:00:00
  Allocating rank array
  Ranking v-sort output
  Ranking v-sort output time: 00:00:00
  Invoking Larsson-Sadakane on ranks
  Invoking Larsson-Sadakane on ranks time: 00:00:00
  Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
  (Using difference cover)
  Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Splitting and merging
  Splitting and merging time: 00:00:00
Split 1, merged 6; iterating...
Splitting and merging
  Splitting and merging time: 00:00:00
Avg bucket size: 3737 (target: 5606)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 8
  Reserving size (5607) for bucket 1
  Calculating Z arrays for bucket 1
  Entering block accumulator loop for bucket 1:
  bucket 1: 10%
  bucket 1: 20%
  bucket 1: 30%
  bucket 1: 40%
  bucket 1: 50%
  bucket 1: 60%
  bucket 1: 70%
  bucket 1: 80%
  bucket 1: 90%
  bucket 1: 100%
  Sorting block of length 2598 for bucket 1
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 2599 for bucket 1
Getting block 2 of 8
  Reserving size (5607) for bucket 2
  Calculating Z arrays for bucket 2
  Entering block accumulator loop for bucket 2:
  bucket 2: 10%
  bucket 2: 20%
  bucket 2: 30%
  bucket 2: 40%
  bucket 2: 50%
  bucket 2: 60%
  bucket 2: 70%
  bucket 2: 80%
  bucket 2: 90%
  bucket 2: 100%
  Sorting block of length 5142 for bucket 2
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 5143 for bucket 2
Getting block 3 of 8
  Reserving size (5607) for bucket 3
  Calculating Z arrays for bucket 3
  Entering block accumulator loop for bucket 3:
  bucket 3: 10%
  bucket 3: 20%
  bucket 3: 30%
  bucket 3: 40%
  bucket 3: 50%
  bucket 3: 60%
  bucket 3: 70%
  bucket 3: 80%
  bucket 3: 90%
  bucket 3: 100%
  Sorting block of length 4371 for bucket 3
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 4372 for bucket 3
Getting block 4 of 8
  Reserving size (5607) for bucket 4
  Calculating Z arrays for bucket 4
  Entering block accumulator loop for bucket 4:
  bucket 4: 10%
  bucket 4: 20%
  bucket 4: 30%
  bucket 4: 40%
  bucket 4: 50%
  bucket 4: 60%
  bucket 4: 70%
  bucket 4: 80%
  bucket 4: 90%
  bucket 4: 100%
  Sorting block of length 4433 for bucket 4
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 4434 for bucket 4
Getting block 5 of 8
  Reserving size (5607) for bucket 5
  Calculating Z arrays for bucket 5
  Entering block accumulator loop for bucket 5:
  bucket 5: 10%
  bucket 5: 20%
  bucket 5: 30%
  bucket 5: 40%
  bucket 5: 50%
  bucket 5: 60%
  bucket 5: 70%
  bucket 5: 80%
  bucket 5: 90%
  bucket 5: 100%
  Sorting block of length 3267 for bucket 5
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 3268 for bucket 5
Getting block 6 of 8
  Reserving size (5607) for bucket 6
  Calculating Z arrays for bucket 6
  Entering block accumulator loop for bucket 6:
  bucket 6: 10%
  bucket 6: 20%
  bucket 6: 30%
  bucket 6: 40%
  bucket 6: 50%
  bucket 6: 60%
  bucket 6: 70%
  bucket 6: 80%
  bucket 6: 90%
  bucket 6: 100%
  Sorting block of length 2880 for bucket 6
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 2881 for bucket 6
Getting block 7 of 8
  Reserving size (5607) for bucket 7
  Calculating Z arrays for bucket 7
  Entering block accumulator loop for bucket 7:
  bucket 7: 10%
  bucket 7: 20%
  bucket 7: 30%
  bucket 7: 40%
  bucket 7: 50%
  bucket 7: 60%
  bucket 7: 70%
  bucket 7: 80%
  bucket 7: 90%
  bucket 7: 100%
  Sorting block of length 5175 for bucket 7
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 5176 for bucket 7
Getting block 8 of 8
  Reserving size (5607) for bucket 8
  Calculating Z arrays for bucket 8
  Entering block accumulator loop for bucket 8:
  bucket 8: 10%
  bucket 8: 20%
  bucket 8: 30%
  bucket 8: 40%
  bucket 8: 50%
  bucket 8: 60%
  bucket 8: 70%
  bucket 8: 80%
  bucket 8: 90%
  bucket 8: 100%
  Sorting block of length 2030 for bucket 8
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 2031 for bucket 8
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 8954
fchr[G]: 14446
fchr[T]: 20309
fchr[$]: 29903
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 4204461 bytes to primary EBWT file: genome.rev.1.bt2.tmp
Wrote 7480 bytes to secondary EBWT file: genome.rev.2.bt2.tmp
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
    len: 29903
    bwtLen: 29904
    sz: 7476
    bwtSz: 7476
    lineRate: 6
    offRate: 4
    offMask: 0xfffffff0
    ftabChars: 10
    eftabLen: 20
    eftabSz: 80
    ftabLen: 1048577
    ftabSz: 4194308
    offsLen: 1869
    offsSz: 7476
    lineSz: 64
    sideSz: 64
    sideBwtSz: 48
    sideBwtLen: 192
    numSides: 156
    numLines: 156
    ebwtTotLen: 9984
    ebwtTotSz: 9984
    color: 0
    reverse: 1
Total time for backward call to driver() for mirror index: 00:00:00

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"}`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 1, "own_file": {"values": [{"id": 1, "src": "hda"}]}, "source": "history"}`
rg	`{"__current_case__": 2, "rg_selector": "set_id_auto"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmp4be7xmbm/files/4/c/5/dataset_4c59b9dc-9950-4b52-a9f0-7f726fa4d918.dat' 'SRR11605118' &&  picard MarkDuplicates  --INPUT 'SRR11605118' --OUTPUT '/tmp/tmp4be7xmbm/job_working_directory/000/5/outputs/dataset_7d5d1be1-5e22-47a0-86d5-231287c84158.dat'  --METRICS_FILE '/tmp/tmp4be7xmbm/job_working_directory/000/5/outputs/dataset_89badad6-c8c3-491c-afed-a5ca707cb905.dat'  --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmp4be7xmbm/tmp
Oct 21, 2024 5:24:01 AM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
Ignoring SAM validation error: ERROR::HEADER_RECORD_MISSING_REQUIRED_TAG:File /tmp/tmp4be7xmbm/job_working_directory/000/5/working/SRR11605118, Error parsing SAM header. @RG line missing SM tag. Line:
@RG	ID:SRR11605118
Ignoring SAM validation error: ERROR::HEADER_RECORD_MISSING_REQUIRED_TAG:File /tmp/tmp4be7xmbm/job_working_directory/000/5/working/SRR11605118, Error parsing SAM header. @RG line missing SM tag. Line:
@RG	ID:SRR11605118

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comments	`[]`
dbkey	`"?"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
inputFile	__identifier__
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`true`
validation_stringency	`"LENIENT"`

Step 6: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is running

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&     ln -s '/tmp/tmp4be7xmbm/files/6/c/5/dataset_6c558f19-9bb4-43f7-9d44-dc7e01b8dcc2.dat' 'multiqc_WDir/fastp_0/SRR11605118fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/SRR11605118fastp.json' || die "'report_title' or 'report_title' not found in the file" &&  mkdir multiqc_WDir/bowtie2_1 &&         grep -q '% overall alignment rate' /tmp/tmp4be7xmbm/files/f/3/a/dataset_f3a3cc8a-dcf5-49f1-bfa8-4bc7cc0d77d2.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR11605118'" && ln -s '/tmp/tmp4be7xmbm/files/f/3/a/dataset_f3a3cc8a-dcf5-49f1-bfa8-4bc7cc0d77d2.dat' 'multiqc_WDir/bowtie2_1/SRR11605118'  &&    mkdir multiqc_WDir/picard_2 &&      mkdir 'multiqc_WDir/picard_2/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmp4be7xmbm/files/8/9/b/dataset_89badad6-c8c3-491c-afed-a5ca707cb905.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR11605118'" && ln -s '/tmp/tmp4be7xmbm/files/8/9/b/dataset_89badad6-c8c3-491c-afed-a5ca707cb905.dat' 'multiqc_WDir/picard_2/markdups_0/SRR11605118'  &&     multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 7, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}]`
saveLog	`"false"`
title	`""`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq viterbi --ref 'reference.fa'  --defqual 2 --out tmp.bam '/tmp/tmp4be7xmbm/files/7/d/5/dataset_7d5d1be1-5e22-47a0-86d5-231287c84158.dat' &&  samtools sort --no-PG -T "${TMPDIR:-.}" -@ ${GALAXY_SLOTS:-1} -O BAM -o '/tmp/tmp4be7xmbm/job_working_directory/000/7/outputs/dataset_e23e0d44-442e-4808-bf6a-d74976786fd9.dat' tmp.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 8: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq indelqual --dindel --ref reference.fa -o output.bam /tmp/tmp4be7xmbm/files/e/2/3/dataset_e23e0d44-442e-4808-bf6a-d74976786fd9.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -s '/tmp/tmp4be7xmbm/files/1/8/3/dataset_183467d3-ba57-48f6-8474-801d53b7d8cf.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  ln -s '/tmp/tmp4be7xmbm/files/6/7/8/dataset_678e255c-dd43-4fc0-8165-57a6e2c17ea2.dat' reads.bam && ln -s -f '/tmp/tmp4be7xmbm/files/_metadata_files/1/3/7/metadata_137b3657-7709-4fbc-b5cf-f9eec0a6f740.dat' reads.bam.bai &&   lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose  --ref 'reference.fa' --out variants.vcf --call-indels   --min-cov 5 --max-depth 1000000  --min-bq 30 --min-alt-bq 30    --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0  --sig 0.0005 --bonf dynamic --no-default-filter  reads.bam 2>&1  || (tool_exit_code=$? && cat "$TMPDIR"/lofreq2_call_parallel*/*.log 1>&2 && exit $tool_exit_code)  && echo set_custom

Exit Code:

```
1
```

Standard Error:

Alive and happily crunching away on pos 39 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.EWLBRC -o /tmp/tmp4be7xmbm/tmp/lofreq2_call_parallel0rgzgok3/0.vcf.gz --no-defaults --snvqual-thresh 64 --indelqual-thresh 53
Number of substitution tests performed: 1539
Number of indel tests performed: 123
Successful exit.
Alive and happily crunching away on pos 14952 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.4zlwnA -o /tmp/tmp4be7xmbm/tmp/lofreq2_call_parallel0rgzgok3/1.vcf.gz --no-defaults --snvqual-thresh 63 --indelqual-thresh 51
Number of substitution tests performed: 1035
Number of indel tests performed: 71
Successful exit.
Alive and happily crunching away on pos 22428 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.LdFq5w -o /tmp/tmp4be7xmbm/tmp/lofreq2_call_parallel0rgzgok3/2.vcf.gz --no-defaults --snvqual-thresh 62 --indelqual-thresh 51
Number of substitution tests performed: 825
Number of indel tests performed: 72
Successful exit.

Standard Output:

INFO [2024-10-21 05:24:33,799]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam

INFO [2024-10-21 05:24:33,814]: Adding 3 commands to mp-pool
Traceback (most recent call last):
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 751, in <module>
    main()
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 678, in main
    concat_vcf_files(vcf_files, vcf_concat,
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 175, in concat_vcf_files
    subprocess.check_call(cmd)
  File "/usr/local/lib/python3.12/subprocess.py", line 408, in check_call
    retcode = call(*popenargs, **kwargs)
              ^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/usr/local/lib/python3.12/subprocess.py", line 389, in call
    with Popen(*popenargs, **kwargs) as p:
         ^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/usr/local/lib/python3.12/subprocess.py", line 1026, in __init__
    self._execute_child(args, executable, preexec_fn, close_fds,
  File "/usr/local/lib/python3.12/subprocess.py", line 1955, in _execute_child
    raise child_exception_type(errno_num, err_msg, err_filename)
FileNotFoundError: [Errno 2] No such file or directory: 'bcftools'

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"83254eda8f6c11efb10d45cbb8c4efdf"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmp4be7xmbm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - 39333e14c2f0ee86
- history_state
  - error
- invocation_id
  - 39333e14c2f0ee86
- invocation_state
  - scheduled
- workflow_id
  - 39333e14c2f0ee86

gxydevbot · 2024-11-18T05:32:42Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2025-01-27T05:31:04Z

There are new updates, they have been integrated to the PR, check the file diff.

…wgs-variant-calling from 0.1.5 to 0.1.6

gxydevbot · 2025-02-10T05:39:21Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot changed the title ~~Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6~~ Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 Sep 23, 2024

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 98d930f to 3e44b5e Compare September 23, 2024 14:48

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 3e44b5e to 5fb8985 Compare September 24, 2024 14:25

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 5fb8985 to 28065bc Compare October 7, 2024 05:23

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 28065bc to b4c3117 Compare October 21, 2024 05:14

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from b4c3117 to 229d6f6 Compare November 18, 2024 05:32

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 229d6f6 to 9c17628 Compare January 27, 2025 05:31

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-…

d7f5721

…wgs-variant-calling from 0.1.5 to 0.1.6

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling branch from 9c17628 to d7f5721 Compare February 10, 2025 05:39

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 #432

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 #432

gxydevbot commented May 27, 2024

gxydevbot commented Sep 23, 2024

github-actions bot commented Sep 23, 2024

Workflow invocation details

gxydevbot commented Sep 24, 2024

github-actions bot commented Sep 24, 2024

Workflow invocation details

gxydevbot commented Oct 7, 2024

github-actions bot commented Oct 7, 2024

Workflow invocation details

gxydevbot commented Oct 21, 2024

github-actions bot commented Oct 21, 2024

Workflow invocation details

gxydevbot commented Nov 18, 2024

gxydevbot commented Jan 27, 2025

gxydevbot commented Feb 10, 2025

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 #432

Are you sure you want to change the base?

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling from 0.1.5 to 0.1.6 #432

Conversation

gxydevbot commented May 27, 2024

gxydevbot commented Sep 23, 2024

github-actions bot commented Sep 23, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Sep 24, 2024

github-actions bot commented Sep 24, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Oct 7, 2024

github-actions bot commented Oct 7, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Oct 21, 2024

github-actions bot commented Oct 21, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Nov 18, 2024

gxydevbot commented Jan 27, 2025

gxydevbot commented Feb 10, 2025