Add coptr module

modules/nf-core/coptr/index/main.nf

@@ -4,8 +4,8 @@ process COPTR_INDEX {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/coptr:1.1.4--pyhdfd78af_1':
-        'biocontainers/coptr:1.1.4--pyhdfd78af_1' }"
+        'https://depot.galaxyproject.org/singularity/coptr:1.1.4--pyhdfd78af_3':
+        'biocontainers/coptr:1.1.4--pyhdfd78af_3' }"
 
     input:
     tuple val(meta), path(indexfasta, stageAs: "fastafolder/*")

modules/nf-core/coptr/index/tests/main.nf.test.snap

@@ -43,10 +43,10 @@
             }
         ],
         "meta": {
-            "nf-test": "0.9.1",
+            "nf-test": "0.9.2",
             "nextflow": "24.10.0"
         },
-        "timestamp": "2024-11-01T15:20:08.028567181"
+        "timestamp": "2024-11-13T13:32:37.002823715"
     },
     "coptr index with multiple fastqs - stub": {
         "content": [
@@ -92,10 +92,10 @@
             }
         ],
         "meta": {
-            "nf-test": "0.9.1",
+            "nf-test": "0.9.2",
             "nextflow": "24.10.0"
         },
-        "timestamp": "2024-11-01T15:28:00.318435045"
+        "timestamp": "2024-11-13T13:32:49.415406628"
     },
     "coptr index with multiple fastqs": {
         "content": [
@@ -141,9 +141,9 @@
             }
         ],
         "meta": {
-            "nf-test": "0.9.1",
+            "nf-test": "0.9.2",
             "nextflow": "24.10.0"
         },
-        "timestamp": "2024-11-01T15:24:04.847842182"
+        "timestamp": "2024-11-13T13:32:43.654868575"
     }
 }

modules/nf-core/coptr/map/environment.yml

@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - "bioconda::coptr=1.1.4"

modules/nf-core/coptr/map/main.nf

@@ -0,0 +1,62 @@
+process COPTR_MAP {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/coptr:1.1.4--pyhdfd78af_3':
+        'biocontainers/coptr:1.1.4--pyhdfd78af_3' }"
+
+    input:
+    tuple val(meta), path(fasta, stageAs: "fastafolder/*")
+    tuple val(meta2), path(index)
+
+    output:
+    tuple val(meta), path("*.bam"), emit: bam
+    path "versions.yml"           , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args   = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def prefix2 = task.ext.prefix ?: "${meta2.id}"
+
+    def paired_end = ""
+    if ( ! meta.single_end ) {
+        paired_end = "--paired"
+    }
+    """
+    INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/\\.rev.1.bt2\$//"`
+    [ -z "\$INDEX" ] && INDEX=`find -L ./ -name "*.rev.1.bt2l" | sed "s/\\.rev.1.bt2l\$//"`
+    [ -z "\$INDEX" ] && echo "Bowtie2 index files not found" 1>&2 && exit 1
+
+    coptr \
+        map \
+        $args $paired_end \
+        --threads $task.cpus \
+        \$INDEX \
+        fastafolder \
+        .
+
+    mv ${prefix}.bam ${prefix}_${prefix2}.bam
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        coptr: \$(coptr |& sed -E '11!d ; s/CoPTR.*?\\(v(.*?)\\).*/\\1/')
+    END_VERSIONS
+    """
+
+    stub:
+    def args   = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.bam
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        "${task.process}":
+            coptr: \$(coptr |& sed -E '11!d ; s/CoPTR.*?\\(v(.*?)\\).*/\\1/')
+    END_VERSIONS
+    """
+}

modules/nf-core/coptr/map/meta.yml

@@ -0,0 +1,65 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
+name: "coptr_map"
+description: write your description here
+keywords:
+  - coptr
+  - mapping
+  - ptr
+tools:
+  - "coptr":
+      description: "Accurate and robust inference of microbial growth dynamics from
+        metagenomic sequencing reads."
+      homepage: "https://github.com/tyjo/coptr"
+      documentation: "https://coptr.readthedocs.io/"
+      tool_dev_url: "https://github.com/tyjo/coptr"
+      doi: "10.1101/gr.275533.121"
+      licence: ["GPL v3"]
+      identifier: biotools:coptr
+
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. `[ id:'sample1', single_end:false ]`
+    - fasta:
+        type: file
+        description: fastq file with reads
+        pattern: "*.{.fastq,.fq,.fastq.gz,fq.gz}"
+        ontologies:
+          - edam: "http://edamontology.org/format_1929"
+  - - meta2:
+        type: map
+        description: |
+          Groovy Map containing index genome id and path
+          e.g. [ id:'test', 'bowtie2' ]
+    - index:
+        type: file
+        description: Directory with Bowtie2 genome index files
+        pattern: "*.ebwt"
+
+output:
+  - bam:
+      - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1', single_end:false ]`
+      - "*.bam":
+          type: file
+          description: BAM file
+          pattern: "*.{bam}"
+          ontologies:
+            - edam: "http://edamontology.org/format_2572"
+
+  - versions:
+      - "versions.yml":
+          type: file
+          description: File containing software versions
+          pattern: "versions.yml"
+
+authors:
+  - "@ramirobarrantes"
+maintainers:
+  - "@ramirobarrantes"

modules/nf-core/coptr/map/tests/main.nf.test

@@ -0,0 +1,100 @@
+nextflow_process {
+
+    name "Test Process COPTR_MAP"
+    script "../main.nf"
+    process "COPTR_MAP"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "coptr"
+    tag "coptr/index"
+    tag "coptr/map"
+
+    setup {
+        run("COPTR_INDEX") {
+            script "../../index/main.nf"
+            process {
+                """
+                input[0] = [
+                    [id:'test_0'],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+    }
+
+    test("sarscov2 - single end test") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test_1', single_end: true ],
+                    file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true)
+                ]
+                input[1] = COPTR_INDEX.out.index_dir
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.bam.collect{bam(it[1]).getReads(10)}).match() },
+                { assert snapshot(process.out.bam.collect{bam(it[1]).getStatistics(include:["readCount"])}).match() }
+            )
+        }
+    }
+
+    test("sarscov2 - paired end") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end: false ],
+                    [
+                        file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
+                        file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
+                    ]
+                ]
+                input[1] = COPTR_INDEX.out.index_dir
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.bam.collect{bam(it[1]).getReads(2)}).match() }
+            )
+        }
+    }
+
+
+    test("sarscov2 - single end - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end: true ],
+                    file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true)
+                ]
+                input[1] = COPTR_INDEX.out.index_dir
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.bam.collect{bam(it[1]).getReads(1)}).match() }
+            )
+        }
+    }
+
+}

modules/nf-core/coptr/map/tests/main.nf.test.snap

@@ -0,0 +1,54 @@
+{
+    "sarscov2 - paired end": {
+        "content": [
+            [
+                [
+                    "ACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA",
+                    "ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG"
+                ]
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.2",
+            "nextflow": "24.10.0"
+        },
+        "timestamp": "2024-11-14T14:59:54.146815"
+    },
+    "sarscov2 - single end test": {
+        "content": [
+            [
+                [
+                    "ACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA",
+                    "GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
+                    "TAGGTGAGTTAGGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTAC",
+                    "GTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTG",
+                    "AACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGT",
+                    "ACTTTCCAAAGTGCAGTCAAAAGAACAATCACGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAG",
+                    "CCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCA",
+                    "GCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGG",
+                    "CAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAATCCTTTGAAAAAAAGGTTTCACTACTTTCGGTTTTG",
+                    "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC"
+                ]
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.2",
+            "nextflow": "24.10.0"
+        },
+        "timestamp": "2024-11-14T14:59:43.606198"
+    },
+    "sarscov2 - single end - stub": {
+        "content": [
+            [
+                [
+
+                ]
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.2",
+            "nextflow": "24.10.0"
+        },
+        "timestamp": "2024-11-14T15:00:02.115"
+    }
+}

nf-test.config

@@ -13,7 +13,7 @@ config {
 
     // load the necessary plugins
     plugins {
-        load "nft-bam@0.3.0"
+        load "nft-bam@0.5.0"
         load "[email protected]"
         load "[email protected]"
     }