remove not-working error handling from GetSequence functions; update …

…links in CONTRIBUTING.md (bebop#352)

CONTRIBUTING.md

@@ -70,9 +70,8 @@ Unsure where to begin contributing to Poly? You can start by looking through the
 
 ### Working on your first Pull Request? 
 
-You can learn how from this *free* series, [How to Contribute to an Open Source Project on GitHub](https://egghead.io/series/how-to-contribute-to-an-open-source-project-on-github).
-
-You can also check out [these](http://makeapullrequest.com/) [tutorials](http://www.firsttimersonly.com/).
+You can learn how from this *free* series, [How to Contribute to an Open Source Project on GitHub](https://egghead.io/courses/how-to-contribute-to-an-open-source-project-on-github).
+You can also check out this [tutorial](http://www.firsttimersonly.com/).
 
 At this point, you're ready to make your changes! Feel free to ask for help; everyone is a beginner at first :smile_cat:
 

bio/genbank/genbank.go

@@ -128,14 +128,10 @@ var (
 // StoreFeatureSequences calls StoreSequence on all features.
 // The resulting JSON is guaranteed to have useful Feature.Sequence values.
 // Useful when exporting for downstream analysis, such as with json.Marshal.
-func (sequence *Genbank) StoreFeatureSequences() error {
+func (sequence *Genbank) StoreFeatureSequences() {
 	for i := range sequence.Features {
-		_, err := sequence.Features[i].StoreSequence()
-		if err != nil {
-			return err
-		}
+		sequence.Features[i].StoreSequence()
 	}
-	return nil
 }
 
 // AddFeature adds a feature to a Genbank struct.
@@ -151,21 +147,18 @@ func (sequence *Genbank) AddFeature(feature *Feature) error {
 }
 
 // GetSequence returns the sequence of a feature.
-func (feature Feature) GetSequence() (string, error) {
+func (feature Feature) GetSequence() string {
 	return getFeatureSequence(feature, feature.Location)
 }
 
 // StoreSequence infers and assigns the value of feature.Sequence
 // if currently an empty string.
-func (feature *Feature) StoreSequence() (string, error) {
+func (feature *Feature) StoreSequence() string {
 	if feature.Sequence != "" {
-		return feature.Sequence, nil
+		return feature.Sequence
 	}
-	seq, err := getFeatureSequence(*feature, feature.Location)
-	if err == nil {
-		feature.Sequence = seq
-	}
-	return seq, err
+	seq := getFeatureSequence(*feature, feature.Location)
+	return seq
 }
 
 // Copy creates deep copy of Feature, which supports safe duplication.
@@ -186,19 +179,15 @@ func CopyLocation(location Location) Location {
 }
 
 // getFeatureSequence takes a feature and location object and returns a sequence string.
-func getFeatureSequence(feature Feature, location Location) (string, error) {
+func getFeatureSequence(feature Feature, location Location) string {
 	var sequenceBuffer bytes.Buffer
 	parentSequence := feature.ParentSequence.Sequence
 
 	if len(location.SubLocations) == 0 {
 		sequenceBuffer.WriteString(parentSequence[location.Start:location.End])
 	} else {
 		for _, subLocation := range location.SubLocations {
-			sequence, err := getFeatureSequence(feature, subLocation)
-			if err != nil {
-				return "", err
-			}
-
+			sequence := getFeatureSequence(feature, subLocation)
 			sequenceBuffer.WriteString(sequence)
 		}
 	}
@@ -209,7 +198,7 @@ func getFeatureSequence(feature Feature, location Location) (string, error) {
 		sequenceString = transform.ReverseComplement(sequenceString)
 	}
 
-	return sequenceString, nil
+	return sequenceString
 }
 
 // WriteTo implements the io.WriterTo interface on genbank records.

bio/genbank/genbank_test.go

@@ -199,7 +199,7 @@ func TestGetSequenceMethod(t *testing.T) {
 	gbk, _ := read("data/t4_intron.gb")
 
 	// Check to see if GetSequence method works on Features struct
-	feature, _ := gbk.Features[1].GetSequence()
+	feature := gbk.Features[1].GetSequence()
 	seq := "atgagattacaacgccagagcatcaaagattcagaagttagaggtaaatggtattttaatatcatcggtaaagattctgaacttgttgaaaaagctgaacatcttttacgtgatatgggatgggaagatgaatgcgatggatgtcctctttatgaagacggagaaagcgcaggattttggatttaccattctgacgtcgagcagtttaaagctgattggaaaattgtgaaaaagtctgtttga"
 	if feature != seq {
 		t.Errorf("Feature GetSequence method has failed. Got this:\n%s instead of \n%s", feature, seq)
@@ -210,21 +210,21 @@ func TestLocationParser(t *testing.T) {
 	gbk, _ := read("data/t4_intron.gb")
 
 	// read 1..243
-	feature, _ := gbk.Features[1].GetSequence()
+	feature := gbk.Features[1].GetSequence()
 	seq := "atgagattacaacgccagagcatcaaagattcagaagttagaggtaaatggtattttaatatcatcggtaaagattctgaacttgttgaaaaagctgaacatcttttacgtgatatgggatgggaagatgaatgcgatggatgtcctctttatgaagacggagaaagcgcaggattttggatttaccattctgacgtcgagcagtttaaagctgattggaaaattgtgaaaaagtctgtttga"
 	if feature != seq {
 		t.Errorf("Feature sequence parser has changed on test '1..243'. Got this:\n%s instead of \n%s", feature, seq)
 	}
 
 	// read join(893..1441,2459..2770)
-	featureJoin, _ := gbk.Features[6].GetSequence()
+	featureJoin := gbk.Features[6].GetSequence()
 	seqJoin := "atgaaacaataccaagatttaattaaagacatttttgaaaatggttatgaaaccgatgatcgtacaggcacaggaacaattgctctgttcggatctaaattacgctgggatttaactaaaggttttcctgcggtaacaactaagaagctcgcctggaaagcttgcattgctgagctaatatggtttttatcaggaagcacaaatgtcaatgatttacgattaattcaacacgattcgttaatccaaggcaaaacagtctgggatgaaaattacgaaaatcaagcaaaagatttaggataccatagcggtgaacttggtccaatttatggaaaacagtggcgtgattttggtggtgtagaccaaattatagaagttattgatcgtattaaaaaactgccaaatgataggcgtcaaattgtttctgcatggaatccagctgaacttaaatatatggcattaccgccttgtcatatgttctatcagtttaatgtgcgtaatggctatttggatttgcagtggtatcaacgctcagtagatgttttcttgggtctaccgtttaatattgcgtcatatgctacgttagttcatattgtagctaagatgtgtaatcttattccaggggatttgatattttctggtggtaatactcatatctatatgaatcacgtagaacaatgtaaagaaattttgaggcgtgaacctaaagagctttgtgagctggtaataagtggtctaccttataaattccgatatctttctactaaagaacaattaaaatatgttcttaaacttaggcctaaagatttcgttcttaacaactatgtatcacaccctcctattaaaggaaagatggcggtgtaa"
 	if featureJoin != seqJoin {
 		t.Errorf("Feature sequence parser has changed on test 'join(893..1441,2459..2770)'. Got this:\n%s instead of \n%s", featureJoin, seqJoin)
 	}
 
 	// read complement(2791..3054)
-	featureComplement, _ := gbk.Features[10].GetSequence()
+	featureComplement := gbk.Features[10].GetSequence()
 	seqComplement := "ttattcactacccggcatagacggcccacgctggaataattcgtcatattgtttttccgttaaaacagtaatatcgtagtaacagtcagaagaagttttaactgtggaaattttattatcaaaatactcacgagtcattttatgagtatagtattttttaccataaatggtaataggctgttctggtcctggaacttctaactcgcttgggttaggaagtgtaaaaagaactacaccagaagtatctttaaatcgtaaaatcat"
 	if featureComplement != seqComplement {
 		t.Errorf("Feature sequence parser has changed on test 'complement(2791..3054)'. Got this:\n%s instead of \n%s", featureComplement, seqComplement)
@@ -235,14 +235,14 @@ func TestLocationParser(t *testing.T) {
 	// that the first sequence should be appended to the reverse sequence, instead of the second sequence
 	// getting appended to the first. Biopython appends the second sequence to the first, and that is logically
 	// the most obvious thing to do, so we are implementing it that way.
-	featureJoinComplement, _ := gbk.Features[3].GetSequence()
+	featureJoinComplement := gbk.Features[3].GetSequence()
 	seqJoinComplement := "ataccaatttaatcattcatttatatactgattccgtaagggttgttacttcatctattttataccaatgcgtttcaaccatttcacgcttgcttatatcatcaagaaaacttgcgtctaattgaactgttgaattaacacgatgccttttaacgatgcgagaaacaactacttcatctgcataaggtaatgcagcatataacagagcaggcccgccaattacacttactttagaattctgatcaagcatagtttcgaatggtgcattagggcttgacacttgaatttcgccgccagaaatgtaagttatatattgctcccaagtaatatagaaatgtgctaaatcgccgtctttagttacaggataatcacgcgcaaggtcacacaccacaatatggctacgaccaggaagtaatgtaggcaatgactggaacgttttagcacccataatcataattgtgccttcagtacgagctttaaaattctggaggtcctttttaactcgtccccatggtaaaccatcacctaaaccgaatgctaattcattaaagccgtcgaccgttttagttggaga"
 	if featureJoinComplement != seqJoinComplement {
 		t.Errorf("Feature sequence parser has changed on test 'join(complement(315..330),complement(339..896))'. Got this:\n%s instead of \n%s", featureJoinComplement, seqJoinComplement)
 	}
 
 	// read complement(join(893..1098,1101..2770))
-	featureComplementJoin, _ := gbk.Features[5].GetSequence()
+	featureComplementJoin := gbk.Features[5].GetSequence()
 	seqComplementJoin := "ttacaccgccatctttcctttaataggagggtgtgatacatagttgttaagaacgaaatctttaggcctaagtttaagaacatattttaattgttctttagtagaaagatatcggaatttataaggtagaccacttattaccagctcacaaagctctttaggttcacgcctcaaaatttctttacattgttctacgtgattcatatagatatgagtattaccaccagaaaatatcaaatcccctggaataagattacacatcttagctacaatatgaactaacgtagcatatgacgcaatattaaacggtagcattatgttcagataaggtcgttaatcttaccccggaattatatccagctgcatgtcaccatgcagagcagactatatctccaacttgttaaagcaagttgtctatcgtttcgagtcacttgaccctactccccaaagggatagtcgttaggcatttatgtagaaccaattccatttatcagattttacacgataagtaactaatccagacgaaattttaaaatgtctagctgcatctgctgcacaatcaaaaataaccccatcacatgaaatctttttaatattactaggctttttacctttcatcttttctgatattttagatttagttatgtctgaatgcttatgattaaagaatgaattattttcacctgaacgatttctgcatttactacaagtataagcagaagtttgtatgcgaacaccgcacttacaaaacttatgggtttctggattccaacgcccgtttttacttccgggtttactgtaaagagctttccgaccatcaggtccaagtttaagcatcttagctttaacagtttcagaacgtttcttaataatttcttcttttaatggatgcgtagaacatgtatcaccaaacgttgcatcagcaatattgtatccattaattttagaattaagctctttaatccaaaaattttctcgttcaataatcaaatctttctcatatggaatttcttccaaaatagaacattcaaacacattaccatgtttgttaaaagacctctgaagttttatagaagaatggcatcctttttctaaatctttaaaatgcctcttccatctcttttcaaaatctttagcacttcctacatatactttattgtttaaagtatttttaatctgataaattccgcttttcataaatacctctttaaatatagaagtatttattaaagggcaagtcctacaatttagcacgggattgtctactagagaggttccccgtttagatagattacaagtataagtcaccttatactcaggcctcaattaacccaagaaaacatctactgagcgttgataccactgcaaatccaaatagccattacgcacattaaactgatagaacatatgacaaggcggtaatgccatatatttaagttcagctggattccatgcagaaacaatttgacgcctatcatttggcagttttttaatacgatcaataacttctataatttggtctacaccaccaaaatcacgccactgttttccataaattggaccaagttcaccgctatggtatcctaaatcttttgcttgattttcgtaattttcatcccagactgttttgccttggattaacgaatcgtgttgaattaatcgtaaatcatacatttgtgcttcctgataaaaaccatattagctcagcaatgcaagctttccaggcgagcttcttagttgttaccgcaggaaaacctttagttaaatcccagcgtaatttagatccgaacagagcaattgttcctgtgcctgtacgatcatcggtttcataaccattttcaaaaatgtctttaattaaatcttggtattgtttcat"
 	if featureComplementJoin != seqComplementJoin {
 		t.Errorf("Feature sequence parser has changed on test 'complement(join(893..1098,1101..2770))'. Got this:\n%s instead of \n%s", featureComplementJoin, seqComplementJoin)
@@ -331,7 +331,7 @@ func TestFeature_GetSequence_Legacy(t *testing.T) {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	if gfpSequence != featureSequence {

bio/polyjson/example_test.go

@@ -116,7 +116,7 @@ func ExamplePoly_AddFeature() {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	fmt.Println(gfpSequence == featureSequence)
@@ -144,7 +144,7 @@ func ExampleFeature_GetSequence() {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	fmt.Println(gfpSequence == featureSequence)

bio/polyjson/polyjson.go

@@ -79,12 +79,12 @@ func (sequence *Poly) AddFeature(feature *Feature) error {
 }
 
 // GetSequence takes a feature and returns a sequence string for that feature.
-func (feature Feature) GetSequence() (string, error) {
+func (feature Feature) GetSequence() string {
 	return getFeatureSequence(feature, feature.Location)
 }
 
 // getFeatureSequence takes a feature and location object and returns a sequence string.
-func getFeatureSequence(feature Feature, location Location) (string, error) {
+func getFeatureSequence(feature Feature, location Location) string {
 	var sequenceBuffer bytes.Buffer
 	var sequenceString string
 	parentSequence := feature.ParentSequence.Sequence
@@ -93,10 +93,7 @@ func getFeatureSequence(feature Feature, location Location) (string, error) {
 		sequenceBuffer.WriteString(parentSequence[location.Start:location.End])
 	} else {
 		for _, subLocation := range location.SubLocations {
-			sequence, err := getFeatureSequence(feature, subLocation)
-			if err != nil { // todo: test error
-				return "", err
-			}
+			sequence := getFeatureSequence(feature, subLocation)
 			sequenceBuffer.WriteString(sequence)
 		}
 	}
@@ -108,7 +105,7 @@ func getFeatureSequence(feature Feature, location Location) (string, error) {
 		sequenceString = sequenceBuffer.String()
 	}
 
-	return sequenceString, nil
+	return sequenceString
 }
 
 // Parse parses a Poly JSON file and adds appropriate pointers to struct.

bio/polyjson/polyjson_test.go

@@ -58,7 +58,7 @@ func TestFeature_GetSequence(t *testing.T) {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	if gfpSequence != featureSequence {

synthesis/codon/codon_test.go

@@ -92,7 +92,7 @@ func TestOptimize(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -125,7 +125,7 @@ func TestOptimizeSameSeed(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -158,7 +158,7 @@ func TestOptimizeDifferentSeed(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -317,7 +317,7 @@ func TestCompromiseCodonTable(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -340,7 +340,7 @@ func TestCompromiseCodonTable(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}
@@ -391,7 +391,7 @@ func TestCapitalizationRegression(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}

synthesis/codon/example_test.go

@@ -38,7 +38,7 @@ func ExampleOptimize() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			// Note: sometimes, genbank files will have annotated CDSs that are pseudo genes (not having triplet codons).
 			// This will shift the entire codon table, messing up the end results. To fix this, make sure to do a modulo
 			// check.
@@ -117,7 +117,7 @@ func ExampleCompromiseCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -140,7 +140,7 @@ func ExampleCompromiseCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}
@@ -175,7 +175,7 @@ func ExampleAddCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -198,7 +198,7 @@ func ExampleAddCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}

tutorials/001_input_output_test.go

@@ -125,7 +125,7 @@ func TestFileIOTutorial(t *testing.T) {
 	// get the sequence of each feature using the GetSequence method.
 
 	feature := puc19.Features[1]
-	featureSequence, _ := feature.GetSequence()       // this is the sequence of the feature
+	featureSequence := feature.GetSequence()          // this is the sequence of the feature
 	expectedFeatureSequence := "gggaaacgcctggtatcttt" // this is what we expect the sequence of the feature to be
 	if featureSequence != expectedFeatureSequence {
 		t.Errorf("Expected feature sequence to be %s but got %s", expectedFeatureSequence, featureSequence)