Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 #389

gxydevbot · 2024-04-08T16:43:29Z

Hello! This is an automated update of the following workflow: workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2c+galaxy1
toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1

The workflow release number has been updated from 0.5.2 to 0.5.3.

github-actions · 2024-06-24T04:51:52Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ pe-artic-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Paired Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( DP > ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1", "select_param_type": "integer"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " ) & ( ( AF * DP ) >= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 1, "component_value": "10", "select_param_type": "integer"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " - 0.5 ) )", "select_param_type": "text"}}]
dbkey	`"?"`

Step 12: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.18:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                 'localref.fa' '/tmp/tmp1okvltvi/files/5/f/0/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat' '/tmp/tmp1okvltvi/files/b/4/2/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp1okvltvi/job_working_directory/000/9/outputs/dataset_32553a94-a101-4fa1-817d-eb5c139fa0a2.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa index localref.fa
[main] Real time: 0.013 sec; CPU: 0.008 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (236.09, 72.41)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (235.71, 72.44)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (186, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 507)
[M::mem_pestat] mean and std.dev: (235.25, 72.64)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 614)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (187, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 505)
[M::mem_pestat] mean and std.dev: (235.77, 72.25)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 611)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (186, 238, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 504)
[M::mem_pestat] mean and std.dev: (234.79, 72.73)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 610)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (185, 238, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 506)
[M::mem_pestat] mean and std.dev: (234.12, 72.68)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 613)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa mem -t 1 -v 1 localref.fa /tmp/tmp1okvltvi/files/5/f/0/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat /tmp/tmp1okvltvi/files/b/4/2/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat
[main] Real time: 10.544 sec; CPU: 10.249 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 4, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": ""}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`

Step 13: toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp1okvltvi/files/3/2/5/dataset_32553a94-a101-4fa1-817d-eb5c139fa0a2.dat' infile && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/c/7/2/metadata_c7229e69-7252-4199-b128-3e4b3d8d20f1.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 1 -F 268 -G 0    -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": ["4", "8", "256"], "exclusive_filter_all": null, "inclusive_filter": ["1"], "library": "", "qname_file": null, "quality": "20", "tag": null}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq viterbi --ref 'reference.fa'  --defqual 2 --out tmp.bam '/tmp/tmp1okvltvi/files/f/1/d/dataset_f1d5ba86-6de4-4ed2-8ddf-dd8c94e34f20.dat' &&  samtools sort --no-PG -T "${TMPDIR:-.}" -@ ${GALAXY_SLOTS:-1} -O BAM -o '/tmp/tmp1okvltvi/job_working_directory/000/11/outputs/dataset_afa04a34-7554-4779-8045-f384aa6b3139.dat' tmp.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 15: toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.5:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp1okvltvi/files/f/1/d/dataset_f1d5ba86-6de4-4ed2-8ddf-dd8c94e34f20.dat' infile && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/9/3/7/metadata_9374a21a-c424-4b24-90bb-4661cc7d468c.dat' infile.bai &&       samtools stats       -@ $addthreads infile   > '/tmp/tmp1okvltvi/job_working_directory/000/12/outputs/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond_region	`{"__current_case__": 0, "select_region": "no"}`
cov_threshold	`None`
coverage_cond	`{"__current_case__": 0, "coverage_select": "no"}`
dbkey	`"?"`
filter_by_flags	`{"__current_case__": 1, "filter_flags": "nofilter"}`
gc_depth	`None`
insert_size	`None`
most_inserts	`None`
read_group	`None`
read_length	`None`
remove_dups	`false`
remove_overlaps	`false`
sparse	`false`
split_output_cond	`{"__current_case__": 0, "split_output_selector": "no"}`
trim_quality	`None`

Step 16: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq indelqual --dindel --ref reference.fa -o output.bam /tmp/tmp1okvltvi/files/a/f/a/dataset_afa04a34-7554-4779-8045-f384aa6b3139.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 17: toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp1okvltvi/files/6/9/5/dataset_69570f6e-eb26-4ff2-b682-b5da8b8ad3e9.dat' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/sanitize_bed.py' bed.bed && ln -s '/tmp/tmp1okvltvi/files/4/7/f/dataset_47fa7230-6519-4bdf-a3a7-ccee61760f5a.dat' amplicon_info_raw.tsv && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/prepare_amplicon_info.py' bed.bed amplicon_info_raw.tsv amplicon_info.tsv && ln -s '/tmp/tmp1okvltvi/files/d/6/7/dataset_d6754ca4-6087-4eed-b1a2-95a8e0dbb01f.dat' sorted.bam && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/2/a/f/metadata_2afdb052-8617-4c01-920e-724ffe24b55a.dat' sorted.bam.bai &&  ivar trim -i sorted.bam -b bed.bed -f amplicon_info.tsv -x 0 -e -m -1 -q 0 -s 4 | samtools sort -@ ${GALAXY_SLOTS:-1} -T "${TMPDIR:-.}" -o trimmed.sorted.bam -

Exit Code:

```
0
```

Standard Error:

Found 218 primers in BED file
Amplicons detected: 
[30, 410] max = 29866
[320, 726] max = 29866
[642, 1028] max = 29866
[943, 1337] max = 29866
[1242, 1651] max = 29866
[1573, 1964] max = 29866
[1868, 2269] max = 29866
[2181, 2592] max = 29866
[2504, 2904] max = 29866
[2826, 3210] max = 29866
[3144, 3531] max = 29866
[3460, 3853] max = 29866
[3771, 4164] max = 29866
[4044, 4450] max = 29866
[4294, 4696] max = 29866
[4636, 5017] max = 29866
[4939, 5321] max = 29866
[5230, 5644] max = 29866
[5563, 5957] max = 29866
[5867, 6272] max = 29866
[6167, 6550] max = 29866
[6466, 6873] max = 29866
[6718, 7117] max = 29866
[7035, 7415] max = 29866
[7305, 7694] max = 29866
[7626, 8019] max = 29866
[7943, 8341] max = 29866
[8249, 8661] max = 29866
[8595, 8983] max = 29866
[8888, 9271] max = 29866
[9204, 9585] max = 29866
[9477, 9858] max = 29866
[9784, 10171] max = 29866
[10076, 10459] max = 29866
[10362, 10763] max = 29866
[10666, 11074] max = 29866
[10999, 11394] max = 29866
[11306, 11693] max = 29866
[11555, 11949] max = 29866
[11863, 12256] max = 29866
[12110, 12490] max = 29866
[12417, 12802] max = 29866
[12710, 13096] max = 29866
[13005, 13400] max = 29866
[13307, 13699] max = 29866
[13599, 13984] max = 29866
[13918, 14299] max = 29866
[14207, 14601] max = 29866
[14545, 14926] max = 29866
[14865, 15246] max = 29866
[15171, 15560] max = 29866
[15481, 15886] max = 29866
[15827, 16209] max = 29866
[16118, 16510] max = 29866
[16416, 16833] max = 29866
[16748, 17152] max = 29866
[17065, 17452] max = 29866
[17381, 17761] max = 29866
[17674, 18062] max = 29866
[17966, 18348] max = 29866
[18253, 18672] max = 29866
[18596, 18979] max = 29866
[18896, 19297] max = 29866
[19204, 19616] max = 29866
[19548, 19939] max = 29866
[19844, 20255] max = 29866
[20172, 20572] max = 29866
[20472, 20890] max = 29866
[20786, 21169] max = 29866
[21075, 21455] max = 29866
[21357, 21743] max = 29866
[21658, 22038] max = 29866
[21961, 22346] max = 29866
[22262, 22650] max = 29866
[22516, 22903] max = 29866
[22797, 23214] max = 29866
[23122, 23522] max = 29866
[23443, 23847] max = 29866
[23789, 24169] max = 29866
[24078, 24467] max = 29866
[24391, 24789] max = 29866
[24696, 25076] max = 29866
[24978, 25369] max = 29866
[25279, 25673] max = 29866
[25601, 25994] max = 29866
[25902, 26315] max = 29866
[26197, 26590] max = 29866
[26520, 26913] max = 29866
[26835, 27227] max = 29866
[27141, 27533] max = 29866
[27446, 27854] max = 29866
[27784, 28172] max = 29866
[28081, 28464] max = 29866
[28394, 28779] max = 29866
[28677, 29063] max = 29866
[28985, 29378] max = 29866
[29288, 29693] max = 29866
[29486, 29866] max = 29866
Reading from sorted.bam
Minimum Read Length based on 1000 reads: 72

-------
Results: 
Primer Name	Read Count
nCoV-2019_1_LEFT	235
nCoV-2019_1_RIGHT	128
nCoV-2019_2_LEFT	20
nCoV-2019_2_RIGHT	48
nCoV-2019_3_LEFT	3882
nCoV-2019_3_RIGHT	5189
nCoV-2019_4_LEFT	8981
nCoV-2019_4_RIGHT	10479
nCoV-2019_5_LEFT	66
nCoV-2019_5_RIGHT	3
nCoV-2019_6_LEFT	0
nCoV-2019_6_RIGHT	2
nCoV-2019_7_LEFT	6
nCoV-2019_7_LEFT_alt0	0
nCoV-2019_7_RIGHT	0
nCoV-2019_7_RIGHT_alt5	7
nCoV-2019_8_LEFT	7
nCoV-2019_8_RIGHT	20
nCoV-2019_9_LEFT	23
nCoV-2019_9_LEFT_alt4	0
nCoV-2019_9_RIGHT	0
nCoV-2019_9_RIGHT_alt2	9
nCoV-2019_10_LEFT	55
nCoV-2019_10_RIGHT	30
nCoV-2019_11_LEFT	16
nCoV-2019_11_RIGHT	11
nCoV-2019_12_LEFT	7
nCoV-2019_12_RIGHT	2
nCoV-2019_13_LEFT	8
nCoV-2019_13_RIGHT	10
nCoV-2019_14_LEFT	7
nCoV-2019_14_LEFT_alt4	1
nCoV-2019_14_RIGHT	3
nCoV-2019_14_RIGHT_alt2	17
nCoV-2019_15_LEFT	0
nCoV-2019_15_LEFT_alt1	12
nCoV-2019_15_RIGHT	0
nCoV-2019_15_RIGHT_alt3	12
nCoV-2019_16_LEFT	80
nCoV-2019_16_RIGHT	29
nCoV-2019_17_LEFT	19
nCoV-2019_17_RIGHT	18
nCoV-2019_18_LEFT	0
nCoV-2019_18_LEFT_alt2	30
nCoV-2019_18_RIGHT	32
nCoV-2019_18_RIGHT_alt1	0
nCoV-2019_19_LEFT	5
nCoV-2019_19_RIGHT	5
nCoV-2019_20_LEFT	54
nCoV-2019_20_RIGHT	28
nCoV-2019_21_LEFT	0
nCoV-2019_21_LEFT_alt2	9
nCoV-2019_21_RIGHT	0
nCoV-2019_21_RIGHT_alt0	2
nCoV-2019_22_LEFT	77
nCoV-2019_22_RIGHT	54
nCoV-2019_23_LEFT	9
nCoV-2019_23_RIGHT	8
nCoV-2019_24_LEFT	62
nCoV-2019_24_RIGHT	17
nCoV-2019_25_LEFT	7
nCoV-2019_25_RIGHT	3
nCoV-2019_26_LEFT	33
nCoV-2019_26_RIGHT	25
nCoV-2019_27_LEFT	107
nCoV-2019_27_RIGHT	35
nCoV-2019_28_LEFT	13
nCoV-2019_28_RIGHT	38
nCoV-2019_29_LEFT	0
nCoV-2019_29_RIGHT	8
nCoV-2019_30_LEFT	11
nCoV-2019_30_RIGHT	22
nCoV-2019_31_LEFT	34
nCoV-2019_31_RIGHT	22
nCoV-2019_32_LEFT	26
nCoV-2019_32_RIGHT	10
nCoV-2019_33_LEFT	10
nCoV-2019_33_RIGHT	19
nCoV-2019_34_LEFT	48
nCoV-2019_34_RIGHT	53
nCoV-2019_35_LEFT	14
nCoV-2019_35_RIGHT	27
nCoV-2019_36_LEFT	17
nCoV-2019_36_RIGHT	27
nCoV-2019_37_LEFT	35
nCoV-2019_37_RIGHT	51
nCoV-2019_38_LEFT	20
nCoV-2019_38_RIGHT	22
nCoV-2019_39_LEFT	97
nCoV-2019_39_RIGHT	26
nCoV-2019_40_LEFT	23
nCoV-2019_40_RIGHT	17
nCoV-2019_41_LEFT	49
nCoV-2019_41_RIGHT	21
nCoV-2019_42_LEFT	1023
nCoV-2019_42_RIGHT	2409
nCoV-2019_43_LEFT	26
nCoV-2019_43_RIGHT	8
nCoV-2019_44_LEFT	0
nCoV-2019_44_LEFT_alt3	58
nCoV-2019_44_RIGHT	0
nCoV-2019_44_RIGHT_alt0	89
nCoV-2019_45_LEFT	3
nCoV-2019_45_LEFT_alt2	4
nCoV-2019_45_RIGHT	0
nCoV-2019_45_RIGHT_alt7	4
nCoV-2019_46_LEFT	0
nCoV-2019_46_LEFT_alt1	4
nCoV-2019_46_RIGHT	0
nCoV-2019_46_RIGHT_alt2	20
nCoV-2019_47_LEFT	33
nCoV-2019_47_RIGHT	22
nCoV-2019_48_LEFT	35
nCoV-2019_48_RIGHT	27
nCoV-2019_49_LEFT	48
nCoV-2019_49_RIGHT	44
nCoV-2019_50_LEFT	34
nCoV-2019_50_RIGHT	21
nCoV-2019_51_LEFT	25
nCoV-2019_51_RIGHT	17
nCoV-2019_52_LEFT	52
nCoV-2019_52_RIGHT	63
nCoV-2019_53_LEFT	26
nCoV-2019_53_RIGHT	23
nCoV-2019_54_LEFT	51
nCoV-2019_54_RIGHT	23
nCoV-2019_55_LEFT	77
nCoV-2019_55_RIGHT	84
nCoV-2019_56_LEFT	5
nCoV-2019_56_RIGHT	18
nCoV-2019_57_LEFT	84
nCoV-2019_57_RIGHT	72
nCoV-2019_58_LEFT	29
nCoV-2019_58_RIGHT	29
nCoV-2019_59_LEFT	8
nCoV-2019_59_RIGHT	2
nCoV-2019_60_LEFT	30
nCoV-2019_60_RIGHT	38
nCoV-2019_61_LEFT	34
nCoV-2019_61_RIGHT	42
nCoV-2019_62_LEFT	18
nCoV-2019_62_RIGHT	14
nCoV-2019_63_LEFT	35
nCoV-2019_63_RIGHT	36
nCoV-2019_64_LEFT	1
nCoV-2019_64_RIGHT	1
nCoV-2019_65_LEFT	31
nCoV-2019_65_RIGHT	61
nCoV-2019_66_LEFT	6
nCoV-2019_66_RIGHT	3
nCoV-2019_67_LEFT	910
nCoV-2019_67_RIGHT	503
nCoV-2019_68_LEFT	58
nCoV-2019_68_RIGHT	144
nCoV-2019_69_LEFT	7504
nCoV-2019_69_RIGHT	5814
nCoV-2019_70_LEFT	43
nCoV-2019_70_RIGHT	12
nCoV-2019_71_LEFT	451
nCoV-2019_71_RIGHT	630
nCoV-2019_72_LEFT	38
nCoV-2019_72_RIGHT	7
nCoV-2019_73_LEFT	91
nCoV-2019_73_RIGHT	58
nCoV-2019_74_LEFT	0
nCoV-2019_74_RIGHT	695
nCoV-2019_75_LEFT	10352
nCoV-2019_75_RIGHT	7650
nCoV-2019_76_LEFT	2
nCoV-2019_76_LEFT_alt3	97
nCoV-2019_76_RIGHT	18
nCoV-2019_76_RIGHT_alt0	44
nCoV-2019_77_LEFT	6745
nCoV-2019_77_RIGHT	12194
nCoV-2019_78_LEFT	93
nCoV-2019_78_RIGHT	10
nCoV-2019_79_LEFT	221
nCoV-2019_79_RIGHT	209
nCoV-2019_80_LEFT	18
nCoV-2019_80_RIGHT	6
nCoV-2019_81_LEFT	10
nCoV-2019_81_RIGHT	12
nCoV-2019_82_LEFT	24
nCoV-2019_82_RIGHT	13
nCoV-2019_83_LEFT	23
nCoV-2019_83_RIGHT	0
nCoV-2019_84_LEFT	16
nCoV-2019_84_RIGHT	18
nCoV-2019_85_LEFT	7
nCoV-2019_85_RIGHT	0
nCoV-2019_86_LEFT	24
nCoV-2019_86_RIGHT	45
nCoV-2019_87_LEFT	9
nCoV-2019_87_RIGHT	14
nCoV-2019_88_LEFT	20
nCoV-2019_88_RIGHT	36
nCoV-2019_89_LEFT	2
nCoV-2019_89_LEFT_alt2	6
nCoV-2019_89_RIGHT	0
nCoV-2019_89_RIGHT_alt4	13
nCoV-2019_90_LEFT	21
nCoV-2019_90_RIGHT	20
nCoV-2019_91_LEFT	41
nCoV-2019_91_RIGHT	24
nCoV-2019_92_LEFT	25
nCoV-2019_92_RIGHT	22
nCoV-2019_93_LEFT	33
nCoV-2019_93_RIGHT	38
nCoV-2019_94_LEFT	72
nCoV-2019_94_RIGHT	18
nCoV-2019_95_LEFT	4
nCoV-2019_95_RIGHT	1
nCoV-2019_96_LEFT	0
nCoV-2019_96_RIGHT	0
nCoV-2019_97_LEFT	7
nCoV-2019_97_RIGHT	24
nCoV-2019_98_LEFT	48
nCoV-2019_98_RIGHT	28

Trimmed primers from 23.08% (90165) of reads.
1.68% (6571) of reads were quality trimmed below the minimum length of 72 bp and were not written to file.
75.71% (295761) of reads started outside of primer regions. Since the -e flag was given, these reads were written to file.
0.15% (604) reads were ignored because they did not fall within an amplicon
13.43% (52453) of reads had their insert size smaller than their read length

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
amplicons	`{"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "filter_by": "yes"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
inc_primers	`true`
min_len	`"1"`
min_qual	`"0"`
primer	`{"__current_case__": 0, "input_bed": {"values": [{"id": 2, "src": "hda"}]}, "source": "history"}`
primer_pos_wiggle	`"0"`
trimmed_length	`{"__current_case__": 1, "filter": "auto"}`
window_width	`"4"`

Step 18: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' reads.bam && ln -s -f '/tmp/tmp1okvltvi/files/_metadata_files/d/4/d/metadata_d4d3e38b-9b6b-4223-9203-811a59c01b1c.dat' reads.bam.bai &&   lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose  --ref 'reference.fa' --out variants.vcf --call-indels   --min-cov 5 --max-depth 1000000  --min-bq 30 --min-alt-bq 30    --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0  --sig 0.0005 --bonf dynamic --no-default-filter  reads.bam 2>&1  || (tool_exit_code=$? && cat "$TMPDIR/lofreq2_call_parallel*/*.log" 1>&2 && exit $tool_exit_code)  && echo set_custom

Exit Code:

```
0
```

Standard Output:

INFO [2024-06-24 04:46:27,377]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam

INFO [2024-06-24 04:46:27,381]: Adding 3 commands to mp-pool
Number of substitution tests performed: 10089
Number of indel tests performed: 2318
INFO [2024-06-24 04:48:15,563]: Executing lofreq filter -i /tmp/tmp1okvltvi/tmp/lofreq2_call_parallel6gdg332b/concat.vcf.gz -o variants.vcf --no-defaults --snvqual-thresh 73 --indelqual-thresh 67

set_custom

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 19: toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' 'SRR11578257' &&  qualimap bamqc -bam 'SRR11578257' -outdir results -outformat html --collect-overlap-pairs -nw 400 --paint-chromosome-limits -hm 3  --skip-duplicated --skip-dup-mode 0 -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158.dat' && mkdir '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && mv results/css/*.css '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && mv results/css/*.png '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.2.2-dev
Built on 2019-11-11 14:05

Selected tool: bamqc
Available memory (Mb): 262
Max memory (Mb): 1073
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Only flagged duplicate alignments will be skipped...
Number of windows: 400, effective number of windows: 399
Chunk of reads size: 1000
Number of threads: 1
Processed 50 out of 399 windows...
Processed 100 out of 399 windows...
Processed 150 out of 399 windows...
Processed 200 out of 399 windows...
Processed 250 out of 399 windows...
Processed 300 out of 399 windows...
Processed 350 out of 399 windows...
Total processed windows:399
Number of reads: 384049
Number of valid reads: 384054
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 384049
Num mapped first of pair: 192026
Num mapped second of pair: 192023
Num singletons: 0
Time taken to analyze reads: 8
Computing descriptors...
numberOfMappedBases: 54865009
referenceSize: 29903
numberOfSequencedBases: 54854904
numberOfAs: 16761938
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 9
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`["0"]`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "400", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/17/configs/tmpw4jjbwbk' > '/tmp/tmp1okvltvi/job_working_directory/000/17/outputs/dataset_c7a65083-7312-4724-bc84-d9b48dfbacef.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( ( DP4[2] + DP4[3] ) >= ( 0.1 * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( 1 * DP ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 3: ARTIC primer BED:
- step_state: scheduled

Step 21: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/18/configs/tmpt0ieircg' > '/tmp/tmp1okvltvi/job_working_directory/000/18/outputs/dataset_160ec68e-8138-4f21-a771-112d0e6e3855.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 22: __FILTER_FAILED_DATASETS__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "748d824c31e411efa2a73db16abbad8e"
      
      input {"values": [{"id": 16, "src": "dce"}]}

Step 23: toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.4.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp1okvltvi/files/6/9/5/dataset_69570f6e-eb26-4ff2-b682-b5da8b8ad3e9.dat' binding_sites.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/5dc33613c288/ivar_removereads/sanitize_bed.py' binding_sites.bed && ln -s '/tmp/tmp1okvltvi/files/4/7/f/dataset_47fa7230-6519-4bdf-a3a7-ccee61760f5a.dat' amplicon_info.tsv && ivar getmasked -i '/tmp/tmp1okvltvi/files/c/7/a/dataset_c7a65083-7312-4724-bc84-d9b48dfbacef.dat' -b binding_sites.bed -f amplicon_info.tsv -p masked_primers &&  python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/5dc33613c288/ivar_removereads/completemask.py' masked_primers.txt amplicon_info.tsv && ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' sorted.bam && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/d/4/d/metadata_d4d3e38b-9b6b-4223-9203-811a59c01b1c.dat' sorted.bam.bai &&  ivar removereads -i sorted.bam -b binding_sites.bed -p removed_reads.bam -t masked_primers.txt

Exit Code:

```
0
```

Standard Error:

Found 218 primers in BED file
Primer pair for nCoV-2019_7_RIGHT not found in BED file.
Primer pair for nCoV-2019_9_LEFT_alt4 not found in BED file.
Primer pair for nCoV-2019_9_RIGHT not found in BED file.
Primer pair for nCoV-2019_11_RIGHT not found in BED file.
Primer pair for nCoV-2019_14_RIGHT not found in BED file.
Primer pair for nCoV-2019_18_LEFT_alt2 not found in BED file.
Primer pair for nCoV-2019_18_RIGHT not found in BED file.
Primer pair for nCoV-2019_20_RIGHT not found in BED file.
Primer pair for nCoV-2019_21_RIGHT not found in BED file.
Primer pair for nCoV-2019_23_RIGHT not found in BED file.
Primer pair for nCoV-2019_44_RIGHT not found in BED file.
Primer pair for nCoV-2019_46_LEFT_alt1 not found in BED file.
Primer pair for nCoV-2019_46_RIGHT not found in BED file.
Primer pair for nCoV-2019_50_RIGHT not found in BED file.
Primer pair for nCoV-2019_76_RIGHT not found in BED file.
Primer pair for nCoV-2019_78_RIGHT not found in BED file.
Primer pair for nCoV-2019_89_RIGHT not found in BED file.
Primer pair for nCoV-2019_91_RIGHT not found in BED file.
Found 218 primers in BED file

Standard Output:

nCoV-2019_6_LEFT
nCoV-2019_58_RIGHT
nCoV-2019_6_LEFT	nCoV-2019_6_RIGHT	nCoV-2019_58_RIGHT	nCoV-2019_58_LEFT

Removing reads primed with any of:
nCoV-2019_58_LEFT	nCoV-2019_58_RIGHT	nCoV-2019_6_LEFT	nCoV-2019_6_RIGHT
Writing to removed_reads.bam
Number of references: 1
Reference Name: NC_045512.2
Reference Length: 29903
Using Region: NC_045512.2
Sorted By Coordinate
Results:
60 reads were removed.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
amplicons	`{"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "computed": "no"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`

Step 24: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "748d824c31e411efa2a73db16abbad8e"
      
      input {"values": [{"id": 26, "src": "hdca"}]}
      
      join_identifier "_"

Step 25: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  ln -s '/tmp/tmp1okvltvi/files/a/4/b/dataset_a4bdfada-6ff6-4594-961d-4c475e53d428.dat' reads.bam && ln -s -f '/tmp/tmp1okvltvi/files/_metadata_files/2/b/6/metadata_2b6f0bb0-c1f5-4e50-8d7b-a3169e29d970.dat' reads.bam.bai &&   lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose  --ref 'reference.fa' --out variants.vcf --call-indels   --min-cov 5 --max-depth 1000000  --min-bq 30 --min-alt-bq 30    --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0  --sig 0.0005 --bonf dynamic --no-default-filter  reads.bam 2>&1  || (tool_exit_code=$? && cat "$TMPDIR/lofreq2_call_parallel*/*.log" 1>&2 && exit $tool_exit_code)  && echo set_custom

Exit Code:

```
0
```

Standard Output:

INFO [2024-06-24 04:48:55,392]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam

INFO [2024-06-24 04:48:55,396]: Adding 3 commands to mp-pool
Number of substitution tests performed: 10071
Number of indel tests performed: 2316
INFO [2024-06-24 04:50:28,224]: Executing lofreq filter -i /tmp/tmp1okvltvi/tmp/lofreq2_call_paralleloujw1r9r/concat.vcf.gz -o variants.vcf --no-defaults --snvqual-thresh 73 --indelqual-thresh 67

set_custom

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 26: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&    ln -s '/tmp/tmp1okvltvi/files/5/d/1/dataset_5d1190a8-b41f-4f27-8650-7e0a8fd8dcda.dat' 'multiqc_WDir/fastp_0/SRR11578257fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/SRR11578257fastp.json' || die "'report_title' or 'report_title' not found in the file" && mkdir multiqc_WDir/samtools_1 &&    mkdir 'multiqc_WDir/samtools_1/stats_0' &&      grep -q 'This file was produced by samtools stats' /tmp/tmp1okvltvi/files/2/8/a/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat || die "Module 'samtools: 'This file was produced by samtools stats' not found in the file 'SRR11578257'" && ln -s '/tmp/tmp1okvltvi/files/2/8/a/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat' 'multiqc_WDir/samtools_1/stats_0/SRR11578257'  &&    mkdir multiqc_WDir/qualimap_2 &&  sample="$(grep 'bam file = ' /tmp/tmp1okvltvi/files/2/5/8/dataset_25893355-7bb9-43b3-9459-40a5b55d4354.dat | sed 's/bam file = //g' | sed 's: ::g')" && dir_name="multiqc_WDir/qualimap_2/${sample}" && mkdir -p ${dir_name} && filepath_1="${dir_name}/genome_results.txt" && ln -sf '/tmp/tmp1okvltvi/files/2/5/8/dataset_25893355-7bb9-43b3-9459-40a5b55d4354.dat' ${filepath_1} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_2="${nested_dir_name}/coverage_histogram.txt" && ln -sf '/tmp/tmp1okvltvi/files/5/1/c/dataset_51cbb163-f7e8-4701-99c5-996f6804f17d.dat' ${filepath_2} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_3="${nested_dir_name}/mapped_reads_gc-content_distribution.txt" && ln -sf '/tmp/tmp1okvltvi/files/6/5/0/dataset_65039446-19b0-40f7-8ba5-fbe7f2ffb9e9.dat' ${filepath_3} &&   multiqc multiqc_WDir --filename 'report'    --export

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.22.3 now available!
|           multiqc | Search path : /tmp/tmp1okvltvi/job_working_directory/000/30/working/multiqc_WDir
|          qualimap | Found 1 BamQC reports
|          samtools | Found 1 stats reports
|             fastp | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | Plots       : report_plots
|           multiqc | MultiQC complete

Standard Output:

|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 5/5

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`true`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 8, "src": "hdca"}]}, "type": "stats"}}], "software": "samtools"}}, {"__index__": 2, "software_cond": {"__current_case__": 20, "input": {"values": [{"id": 27, "src": "hdca"}]}, "software": "qualimap"}}]`
saveLog	`false`
title	`""`

Step 27: toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export BCFTOOLS_PLUGINS=`which bcftools | sed 's,bin/bcftools,libexec/bcftools,'`;     bgzip -c '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' > input.vcf.gz && bcftools index input.vcf.gz &&   bgzip -c '/tmp/tmp1okvltvi/files/a/a/8/dataset_aa8a2b1d-4c10-4004-a7fb-6f41522b6a50.dat' > annotations.vcf.gz && bcftools index annotations.vcf.gz &&  bcftools annotate       --columns 'QUAL,INFO'  --annotations 'annotations.vcf.gz'  --mark-sites '-AmpliconBias'                   --output-type 'v'   --threads ${GALAXY_SLOTS:-4}    input.vcf.gz  > '/tmp/tmp1okvltvi/job_working_directory/000/21/outputs/dataset_f5440a59-a807-4c22-b64a-60ffcd273409.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
output_type	`"v"`
sec_annofile	`{"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 34, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "-AmpliconBias", "min_overlap": "", "set_id": ""}`
sec_annotate	`{"remove": "", "rename_annots": null, "rename_chrs": null}`
sec_restrict	`{"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null}`

Step 28: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/a/a/8/dataset_aa8a2b1d-4c10-4004-a7fb-6f41522b6a50.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/22/configs/tmpqx6qwi61' > '/tmp/tmp1okvltvi/job_working_directory/000/22/outputs/dataset_f8572558-1be6-44c1-9476-6ffbd58d2cc1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 29: toolshed.g2.bx.psu.edu/repos/devteam/vcfvcfintersect/vcfvcfintersect/1.0.0_rc3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' 'localref.fa' &&  vcfintersect  -v -r 'localref.fa' -w "0" -i '/tmp/tmp1okvltvi/files/f/8/5/dataset_f8572558-1be6-44c1-9476-6ffbd58d2cc1.dat' '/tmp/tmp1okvltvi/files/1/6/0/dataset_160ec68e-8138-4f21-a771-112d0e6e3855.dat' > '/tmp/tmp1okvltvi/job_working_directory/000/23/outputs/dataset_c100d280-03cd-44b9-9c26-3aaf4a0e45a7.dat'

Exit Code:

```
125
```

Standard Error:

Unable to find image 'quay.io/biocontainers/vcflib:1.0.0_rc3--py37hc088bd4_0' locally
1.0.0_rc3--py37hc088bd4_0: Pulling from biocontainers/vcflib
docker: [DEPRECATION NOTICE] Docker Image Format v1 and Docker Image manifest version 2, schema 1 support is disabled by default and will be removed in an upcoming release. Suggest the author of quay.io/biocontainers/vcflib:1.0.0_rc3--py37hc088bd4_0 to upgrade the image to the OCI Format or Docker Image manifest v2, schema 2. More information at https://docs.docker.com/go/deprecated-image-specs/.
See 'docker run --help'.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
adv_options	`{"__current_case__": 0, "adv_options_selector": "no"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`true`
isect_union	`"-i"`
loci	`false`
reference_source	`{"__current_case__": 1, "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"}`
window_size	`"0"`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
output_type	`"v"`
sec_annofile	`{"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 37, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "+AmpliconBias", "min_overlap": "", "set_id": ""}`
sec_annotate	`{"remove": "", "rename_annots": null, "rename_chrs": null}`
sec_restrict	`{"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null}`

Step 4: ARTIC primers to amplicon assignments:
- step_state: scheduled

Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "^##INFO=<ID=AmpliconBias,.+$", "replace_pattern": "##INFO=<ID=AmpliconBias,Number=0,Type=Flag,Description=\"Indicates that the AF value of the variant could not be corrected for potential amplicon bias.\">"}, {"__index__": 1, "find_pattern": "^##INFO=<ID=AF,.+$", "replace_pattern": "##INFO=<ID=AF,Number=1,Type=Float,Description=\"Lofreq Allele Frequency; Fraction of variant-supporting bases with q > --min-bq among all bases at the site\">"}]`

Step 32: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 33: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Step 5: Read removal minimum AF:
- step_state: scheduled
Step 6: Read removal maximum AF:
- step_state: scheduled
Step 7: Minimum DP required after amplicon bias correction:
- step_state: scheduled
Step 8: Minimum DP_ALT required after amplicon bias correction:
- step_state: scheduled

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmp1okvltvi/files/8/6/4/dataset_86457b47-8aaa-4190-9ae7-9f7fe3b09db3.dat' 'SRR11578257.fastq.gz' && ln -sf '/tmp/tmp1okvltvi/files/4/5/e/dataset_45e19ace-7030-48d9-a8c9-4e60e6e3c95d.dat' 'SRR11578257_R2.fastq.gz' &&    fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11578257.fastq.gz'   -i 'SRR11578257.fastq.gz' -o first.fastq.gz  -I 'SRR11578257_R2.fastq.gz' -O second.fastq.gz       --detect_adapter_for_pe                                          &&  mv first.fastq.gz '/tmp/tmp1okvltvi/job_working_directory/000/6/outputs/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat' && mv second.fastq.gz '/tmp/tmp1okvltvi/job_working_directory/000/6/outputs/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
ACCTTAGAATCAAGATTGTTAGAATTCCAAGCTATAACGCAGCCTGTAAAATCATCTGGT

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 201367
total bases: 29302687
Q20 bases: 28139796(96.0315%)
Q30 bases: 27281893(93.1037%)

Read2 before filtering:
total reads: 201367
total bases: 29398146
Q20 bases: 27778430(94.4904%)
Q30 bases: 26748339(90.9865%)

Read1 after filtering:
total reads: 195579
total bases: 28439132
Q20 bases: 27427010(96.4411%)
Q30 bases: 26623439(93.6155%)

Read2 after filtering:
total reads: 195579
total bases: 28450670
Q20 bases: 27054927(95.0942%)
Q30 bases: 26092568(91.7116%)

Filtering result:
reads passed filter: 391158
reads failed due to low quality: 5634
reads failed due to too many N: 1164
reads failed due to too short: 4778
reads with adapter trimmed: 18954
bases trimmed due to adapters: 261387

Duplication rate: 20.2521%

Insert size peak (evaluated by paired-end reads): 230

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR11578257.fastq.gz -i SRR11578257.fastq.gz -o first.fastq.gz -I SRR11578257_R2.fastq.gz -O second.fastq.gz --detect_adapter_for_pe 
fastp v0.23.4, time used: 12 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 2, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "paired_input": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"748d824c31e411efa2a73db16abbad8e"`
chromInfo	`"/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( ( DP4[2] + DP4[3] ) >= ( ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 2, "component_value": "0.1", "select_param_type": "float"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 2, "component_value": "1.0", "select_param_type": "float"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " * DP ) )", "select_param_type": "text"}}]
dbkey	`"?"`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - 97ab1d6a8bc6a7c3
- history_state
  - error
- invocation_id
  - 97ab1d6a8bc6a7c3
- invocation_state
  - scheduled
- workflow_id
  - 97ab1d6a8bc6a7c3

gxydevbot · 2024-09-23T14:45:34Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2024-09-24T14:22:26Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2024-10-07T05:19:17Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2024-10-21T05:10:51Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-10-21T05:26:12Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ pe-artic-variation.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: Paired Collection:
- step_state: scheduled
Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2:
- step_state: scheduled

Step 11: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( DP > ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1", "select_param_type": "integer"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " ) & ( ( AF * DP ) >= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 1, "component_value": "10", "select_param_type": "integer"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " - 0.5 ) )", "select_param_type": "text"}}]
dbkey	`"?"`

Step 12: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.18:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp4o_5qgnm/files/9/e/3/dataset_9e328ff8-7ddf-4fd6-a1ab-2aec4f32ed65.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                 'localref.fa' '/tmp/tmp4o_5qgnm/files/7/1/4/dataset_71440cac-ac46-473f-b4c6-183ec3841d8d.dat' '/tmp/tmp4o_5qgnm/files/3/7/5/dataset_37548cdf-335f-476e-84a7-a31a6c68a70b.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp4o_5qgnm/job_working_directory/000/9/outputs/dataset_28e48dc3-14d5-4efd-bf3e-126772650661.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa index localref.fa
[main] Real time: 0.016 sec; CPU: 0.008 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (236.48, 72.34)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (235.85, 72.46)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (187, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 505)
[M::mem_pestat] mean and std.dev: (235.52, 72.51)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 611)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (236.18, 72.42)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (186, 239, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 504)
[M::mem_pestat] mean and std.dev: (235.20, 72.50)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 610)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (185, 238, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 506)
[M::mem_pestat] mean and std.dev: (234.36, 72.83)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 613)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa mem -t 1 -v 1 localref.fa /tmp/tmp4o_5qgnm/files/7/1/4/dataset_71440cac-ac46-473f-b4c6-183ec3841d8d.dat /tmp/tmp4o_5qgnm/files/3/7/5/dataset_37548cdf-335f-476e-84a7-a31a6c68a70b.dat
[main] Real time: 10.551 sec; CPU: 10.270 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 4, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": ""}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`

Step 13: toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp4o_5qgnm/files/2/8/e/dataset_28e48dc3-14d5-4efd-bf3e-126772650661.dat' infile && ln -s '/tmp/tmp4o_5qgnm/files/_metadata_files/b/d/8/metadata_bd8aafe0-cfc9-4c2e-a252-675664667e79.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 1 -F 268 -G 0   -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_expr": {"__current_case__": 0, "select_expr": "no"}, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": ["4", "8", "256"], "exclusive_filter_all": null, "inclusive_filter": ["1"], "library": "", "qname_file": null, "quality": "20", "tag": null}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp4o_5qgnm/files/9/e/3/dataset_9e328ff8-7ddf-4fd6-a1ab-2aec4f32ed65.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq viterbi --ref 'reference.fa'  --defqual 2 --out tmp.bam '/tmp/tmp4o_5qgnm/files/7/1/2/dataset_71287eca-14a5-4d97-8de9-c13a78245bac.dat' &&  samtools sort --no-PG -T "${TMPDIR:-.}" -@ ${GALAXY_SLOTS:-1} -O BAM -o '/tmp/tmp4o_5qgnm/job_working_directory/000/11/outputs/dataset_3b7f55dd-f921-4a06-80a7-d454e63d7fa3.dat' tmp.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
adv_options	`{"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`

Step 15: toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.5:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp4o_5qgnm/files/7/1/2/dataset_71287eca-14a5-4d97-8de9-c13a78245bac.dat' infile && ln -s '/tmp/tmp4o_5qgnm/files/_metadata_files/d/b/5/metadata_db51ef88-d0e8-4ef2-8875-beffedf761d9.dat' infile.bai &&       samtools stats       -@ $addthreads infile   > '/tmp/tmp4o_5qgnm/job_working_directory/000/12/outputs/dataset_b63259bc-59d7-4118-85bd-7e6be90a9caf.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond_region	`{"__current_case__": 0, "select_region": "no"}`
cov_threshold	`None`
coverage_cond	`{"__current_case__": 0, "coverage_select": "no"}`
dbkey	`"?"`
filter_by_flags	`{"__current_case__": 1, "filter_flags": "nofilter"}`
gc_depth	`None`
insert_size	`None`
most_inserts	`None`
read_group	`None`
read_length	`None`
remove_dups	`false`
remove_overlaps	`false`
sparse	`false`
split_output_cond	`{"__current_case__": 0, "split_output_selector": "no"}`
trim_quality	`None`

Step 16: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp4o_5qgnm/files/9/e/3/dataset_9e328ff8-7ddf-4fd6-a1ab-2aec4f32ed65.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  lofreq indelqual --dindel --ref reference.fa -o output.bam /tmp/tmp4o_5qgnm/files/3/b/7/dataset_3b7f55dd-f921-4a06-80a7-d454e63d7fa3.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
strategy	`{"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"}`

Step 17: toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp4o_5qgnm/files/4/3/2/dataset_43260de7-5bcb-4d51-8e0b-f92b3272ce9f.dat' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/sanitize_bed.py' bed.bed && ln -s '/tmp/tmp4o_5qgnm/files/4/0/9/dataset_409e9b70-1e85-462a-b5bc-141bce70122e.dat' amplicon_info_raw.tsv && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/prepare_amplicon_info.py' bed.bed amplicon_info_raw.tsv amplicon_info.tsv && ln -s '/tmp/tmp4o_5qgnm/files/3/7/5/dataset_375692a0-2801-456e-b977-e830742a1d09.dat' sorted.bam && ln -s '/tmp/tmp4o_5qgnm/files/_metadata_files/1/f/a/metadata_1fa2aca7-2595-4107-b990-9941fbff0107.dat' sorted.bam.bai &&  ivar trim -i sorted.bam -b bed.bed -f amplicon_info.tsv -x 0 -e -m -1 -q 0 -s 4 | samtools sort -@ ${GALAXY_SLOTS:-1} -T "${TMPDIR:-.}" -o trimmed.sorted.bam -

Exit Code:

```
0
```

Standard Error:

Found 218 primers in BED file
Amplicons detected: 
[30, 410] max = 29866
[320, 726] max = 29866
[642, 1028] max = 29866
[943, 1337] max = 29866
[1242, 1651] max = 29866
[1573, 1964] max = 29866
[1868, 2269] max = 29866
[2181, 2592] max = 29866
[2504, 2904] max = 29866
[2826, 3210] max = 29866
[3144, 3531] max = 29866
[3460, 3853] max = 29866
[3771, 4164] max = 29866
[4044, 4450] max = 29866
[4294, 4696] max = 29866
[4636, 5017] max = 29866
[4939, 5321] max = 29866
[5230, 5644] max = 29866
[5563, 5957] max = 29866
[5867, 6272] max = 29866
[6167, 6550] max = 29866
[6466, 6873] max = 29866
[6718, 7117] max = 29866
[7035, 7415] max = 29866
[7305, 7694] max = 29866
[7626, 8019] max = 29866
[7943, 8341] max = 29866
[8249, 8661] max = 29866
[8595, 8983] max = 29866
[8888, 9271] max = 29866
[9204, 9585] max = 29866
[9477, 9858] max = 29866
[9784, 10171] max = 29866
[10076, 10459] max = 29866
[10362, 10763] max = 29866
[10666, 11074] max = 29866
[10999, 11394] max = 29866
[11306, 11693] max = 29866
[11555, 11949] max = 29866
[11863, 12256] max = 29866
[12110, 12490] max = 29866
[12417, 12802] max = 29866
[12710, 13096] max = 29866
[13005, 13400] max = 29866
[13307, 13699] max = 29866
[13599, 13984] max = 29866
[13918, 14299] max = 29866
[14207, 14601] max = 29866
[14545, 14926] max = 29866
[14865, 15246] max = 29866
[15171, 15560] max = 29866
[15481, 15886] max = 29866
[15827, 16209] max = 29866
[16118, 16510] max = 29866
[16416, 16833] max = 29866
[16748, 17152] max = 29866
[17065, 17452] max = 29866
[17381, 17761] max = 29866
[17674, 18062] max = 29866
[17966, 18348] max = 29866
[18253, 18672] max = 29866
[18596, 18979] max = 29866
[18896, 19297] max = 29866
[19204, 19616] max = 29866
[19548, 19939] max = 29866
[19844, 20255] max = 29866
[20172, 20572] max = 29866
[20472, 20890] max = 29866
[20786, 21169] max = 29866
[21075, 21455] max = 29866
[21357, 21743] max = 29866
[21658, 22038] max = 29866
[21961, 22346] max = 29866
[22262, 22650] max = 29866
[22516, 22903] max = 29866
[22797, 23214] max = 29866
[23122, 23522] max = 29866
[23443, 23847] max = 29866
[23789, 24169] max = 29866
[24078, 24467] max = 29866
[24391, 24789] max = 29866
[24696, 25076] max = 29866
[24978, 25369] max = 29866
[25279, 25673] max = 29866
[25601, 25994] max = 29866
[25902, 26315] max = 29866
[26197, 26590] max = 29866
[26520, 26913] max = 29866
[26835, 27227] max = 29866
[27141, 27533] max = 29866
[27446, 27854] max = 29866
[27784, 28172] max = 29866
[28081, 28464] max = 29866
[28394, 28779] max = 29866
[28677, 29063] max = 29866
[28985, 29378] max = 29866
[29288, 29693] max = 29866
[29486, 29866] max = 29866
Reading from sorted.bam
Minimum Read Length based on 1000 reads: 72

-------
Results: 
Primer Name	Read Count
nCoV-2019_1_LEFT	235
nCoV-2019_1_RIGHT	128
nCoV-2019_2_LEFT	20
nCoV-2019_2_RIGHT	48
nCoV-2019_3_LEFT	3882
nCoV-2019_3_RIGHT	5189
nCoV-2019_4_LEFT	8981
nCoV-2019_4_RIGHT	10479
nCoV-2019_5_LEFT	66
nCoV-2019_5_RIGHT	3
nCoV-2019_6_LEFT	0
nCoV-2019_6_RIGHT	2
nCoV-2019_7_LEFT	6
nCoV-2019_7_LEFT_alt0	0
nCoV-2019_7_RIGHT	0
nCoV-2019_7_RIGHT_alt5	7
nCoV-2019_8_LEFT	7
nCoV-2019_8_RIGHT	20
nCoV-2019_9_LEFT	23
nCoV-2019_9_LEFT_alt4	0
nCoV-2019_9_RIGHT	0
nCoV-2019_9_RIGHT_alt2	9
nCoV-2019_10_LEFT	55
nCoV-2019_10_RIGHT	30
nCoV-2019_11_LEFT	16
nCoV-2019_11_RIGHT	11
nCoV-2019_12_LEFT	7
nCoV-2019_12_RIGHT	2
nCoV-2019_13_LEFT	8
nCoV-2019_13_RIGHT	10
nCoV-2019_14_LEFT	7
nCoV-2019_14_LEFT_alt4	1
nCoV-2019_14_RIGHT	3
nCoV-2019_14_RIGHT_alt2	17
nCoV-2019_15_LEFT	0
nCoV-2019_15_LEFT_alt1	12
nCoV-2019_15_RIGHT	0
nCoV-2019_15_RIGHT_alt3	12
nCoV-2019_16_LEFT	80
nCoV-2019_16_RIGHT	29
nCoV-2019_17_LEFT	19
nCoV-2019_17_RIGHT	18
nCoV-2019_18_LEFT	0
nCoV-2019_18_LEFT_alt2	30
nCoV-2019_18_RIGHT	32
nCoV-2019_18_RIGHT_alt1	0
nCoV-2019_19_LEFT	5
nCoV-2019_19_RIGHT	5
nCoV-2019_20_LEFT	54
nCoV-2019_20_RIGHT	28
nCoV-2019_21_LEFT	0
nCoV-2019_21_LEFT_alt2	9
nCoV-2019_21_RIGHT	0
nCoV-2019_21_RIGHT_alt0	2
nCoV-2019_22_LEFT	77
nCoV-2019_22_RIGHT	54
nCoV-2019_23_LEFT	9
nCoV-2019_23_RIGHT	8
nCoV-2019_24_LEFT	62
nCoV-2019_24_RIGHT	17
nCoV-2019_25_LEFT	7
nCoV-2019_25_RIGHT	3
nCoV-2019_26_LEFT	33
nCoV-2019_26_RIGHT	25
nCoV-2019_27_LEFT	107
nCoV-2019_27_RIGHT	35
nCoV-2019_28_LEFT	13
nCoV-2019_28_RIGHT	38
nCoV-2019_29_LEFT	0
nCoV-2019_29_RIGHT	8
nCoV-2019_30_LEFT	11
nCoV-2019_30_RIGHT	22
nCoV-2019_31_LEFT	34
nCoV-2019_31_RIGHT	22
nCoV-2019_32_LEFT	26
nCoV-2019_32_RIGHT	10
nCoV-2019_33_LEFT	10
nCoV-2019_33_RIGHT	19
nCoV-2019_34_LEFT	48
nCoV-2019_34_RIGHT	53
nCoV-2019_35_LEFT	14
nCoV-2019_35_RIGHT	27
nCoV-2019_36_LEFT	17
nCoV-2019_36_RIGHT	27
nCoV-2019_37_LEFT	35
nCoV-2019_37_RIGHT	51
nCoV-2019_38_LEFT	20
nCoV-2019_38_RIGHT	22
nCoV-2019_39_LEFT	97
nCoV-2019_39_RIGHT	26
nCoV-2019_40_LEFT	23
nCoV-2019_40_RIGHT	17
nCoV-2019_41_LEFT	49
nCoV-2019_41_RIGHT	21
nCoV-2019_42_LEFT	1023
nCoV-2019_42_RIGHT	2409
nCoV-2019_43_LEFT	26
nCoV-2019_43_RIGHT	8
nCoV-2019_44_LEFT	0
nCoV-2019_44_LEFT_alt3	58
nCoV-2019_44_RIGHT	0
nCoV-2019_44_RIGHT_alt0	89
nCoV-2019_45_LEFT	3
nCoV-2019_45_LEFT_alt2	4
nCoV-2019_45_RIGHT	0
nCoV-2019_45_RIGHT_alt7	4
nCoV-2019_46_LEFT	0
nCoV-2019_46_LEFT_alt1	4
nCoV-2019_46_RIGHT	0
nCoV-2019_46_RIGHT_alt2	20
nCoV-2019_47_LEFT	33
nCoV-2019_47_RIGHT	22
nCoV-2019_48_LEFT	35
nCoV-2019_48_RIGHT	27
nCoV-2019_49_LEFT	48
nCoV-2019_49_RIGHT	44
nCoV-2019_50_LEFT	34
nCoV-2019_50_RIGHT	21
nCoV-2019_51_LEFT	25
nCoV-2019_51_RIGHT	17
nCoV-2019_52_LEFT	52
nCoV-2019_52_RIGHT	63
nCoV-2019_53_LEFT	26
nCoV-2019_53_RIGHT	23
nCoV-2019_54_LEFT	51
nCoV-2019_54_RIGHT	23
nCoV-2019_55_LEFT	77
nCoV-2019_55_RIGHT	84
nCoV-2019_56_LEFT	5
nCoV-2019_56_RIGHT	18
nCoV-2019_57_LEFT	84
nCoV-2019_57_RIGHT	72
nCoV-2019_58_LEFT	29
nCoV-2019_58_RIGHT	29
nCoV-2019_59_LEFT	8
nCoV-2019_59_RIGHT	2
nCoV-2019_60_LEFT	30
nCoV-2019_60_RIGHT	38
nCoV-2019_61_LEFT	34
nCoV-2019_61_RIGHT	42
nCoV-2019_62_LEFT	18
nCoV-2019_62_RIGHT	14
nCoV-2019_63_LEFT	35
nCoV-2019_63_RIGHT	36
nCoV-2019_64_LEFT	1
nCoV-2019_64_RIGHT	1
nCoV-2019_65_LEFT	31
nCoV-2019_65_RIGHT	61
nCoV-2019_66_LEFT	6
nCoV-2019_66_RIGHT	3
nCoV-2019_67_LEFT	910
nCoV-2019_67_RIGHT	503
nCoV-2019_68_LEFT	58
nCoV-2019_68_RIGHT	144
nCoV-2019_69_LEFT	7504
nCoV-2019_69_RIGHT	5814
nCoV-2019_70_LEFT	43
nCoV-2019_70_RIGHT	12
nCoV-2019_71_LEFT	451
nCoV-2019_71_RIGHT	630
nCoV-2019_72_LEFT	38
nCoV-2019_72_RIGHT	7
nCoV-2019_73_LEFT	91
nCoV-2019_73_RIGHT	58
nCoV-2019_74_LEFT	0
nCoV-2019_74_RIGHT	695
nCoV-2019_75_LEFT	10574
nCoV-2019_75_RIGHT	10227
nCoV-2019_76_LEFT	2
nCoV-2019_76_LEFT_alt3	107
nCoV-2019_76_RIGHT	18
nCoV-2019_76_RIGHT_alt0	44
nCoV-2019_77_LEFT	6745
nCoV-2019_77_RIGHT	12194
nCoV-2019_78_LEFT	93
nCoV-2019_78_RIGHT	10
nCoV-2019_79_LEFT	221
nCoV-2019_79_RIGHT	209
nCoV-2019_80_LEFT	18
nCoV-2019_80_RIGHT	6
nCoV-2019_81_LEFT	10
nCoV-2019_81_RIGHT	12
nCoV-2019_82_LEFT	24
nCoV-2019_82_RIGHT	13
nCoV-2019_83_LEFT	23
nCoV-2019_83_RIGHT	0
nCoV-2019_84_LEFT	16
nCoV-2019_84_RIGHT	18
nCoV-2019_85_LEFT	7
nCoV-2019_85_RIGHT	0
nCoV-2019_86_LEFT	24
nCoV-2019_86_RIGHT	45
nCoV-2019_87_LEFT	9
nCoV-2019_87_RIGHT	14
nCoV-2019_88_LEFT	20
nCoV-2019_88_RIGHT	36
nCoV-2019_89_LEFT	2
nCoV-2019_89_LEFT_alt2	6
nCoV-2019_89_RIGHT	0
nCoV-2019_89_RIGHT_alt4	13
nCoV-2019_90_LEFT	21
nCoV-2019_90_RIGHT	20
nCoV-2019_91_LEFT	41
nCoV-2019_91_RIGHT	24
nCoV-2019_92_LEFT	25
nCoV-2019_92_RIGHT	22
nCoV-2019_93_LEFT	33
nCoV-2019_93_RIGHT	38
nCoV-2019_94_LEFT	72
nCoV-2019_94_RIGHT	18
nCoV-2019_95_LEFT	4
nCoV-2019_95_RIGHT	1
nCoV-2019_96_LEFT	0
nCoV-2019_96_RIGHT	0
nCoV-2019_97_LEFT	7
nCoV-2019_97_RIGHT	24
nCoV-2019_98_LEFT	48
nCoV-2019_98_RIGHT	28

Trimmed primers from 23.51% (92964) of reads.
1.67% (6617) of reads were quality trimmed below the minimum length of 72 bp and were not written to file.
75.3% (297732) of reads started outside of primer regions. Since the -e flag was given, these reads were written to file.
0.15% (604) reads were ignored because they did not fall within an amplicon
13.29% (52554) of reads had their insert size smaller than their read length

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
amplicons	`{"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "filter_by": "yes"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
inc_primers	`true`
min_len	`"1"`
min_qual	`"0"`
primer	`{"__current_case__": 0, "input_bed": {"values": [{"id": 2, "src": "hda"}]}, "source": "history"}`
primer_pos_wiggle	`"0"`
trimmed_length	`{"__current_case__": 1, "filter": "auto"}`
window_width	`"4"`

Step 18: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

ln -s '/tmp/tmp4o_5qgnm/files/9/e/3/dataset_9e328ff8-7ddf-4fd6-a1ab-2aec4f32ed65.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 &&  ln -s '/tmp/tmp4o_5qgnm/files/e/e/6/dataset_ee6e91cc-e5c9-45bd-ac35-d2ae68737e6c.dat' reads.bam && ln -s -f '/tmp/tmp4o_5qgnm/files/_metadata_files/b/c/8/metadata_bc8025a7-aeae-4bb7-97bd-698c6c955f73.dat' reads.bam.bai &&   lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose  --ref 'reference.fa' --out variants.vcf --call-indels   --min-cov 5 --max-depth 1000000  --min-bq 30 --min-alt-bq 30    --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0  --sig 0.0005 --bonf dynamic --no-default-filter  reads.bam 2>&1  || (tool_exit_code=$? && cat "$TMPDIR"/lofreq2_call_parallel*/*.log 1>&2 && exit $tool_exit_code)  && echo set_custom

Exit Code:

```
1
```

Standard Error:

Alive and happily crunching away on pos 55 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.g1qSpX -o /tmp/tmp4o_5qgnm/tmp/lofreq2_call_parallelrl_qk5ep/0.vcf.gz --no-defaults --snvqual-thresh 69 --indelqual-thresh 62
Number of substitution tests performed: 4443
Number of indel tests performed: 953
Successful exit.
Alive and happily crunching away on pos 14952 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.HAe3DU -o /tmp/tmp4o_5qgnm/tmp/lofreq2_call_parallelrl_qk5ep/1.vcf.gz --no-defaults --snvqual-thresh 67 --indelqual-thresh 60
Number of substitution tests performed: 2748
Number of indel tests performed: 556
Successful exit.
Alive and happily crunching away on pos 22542 of NC_045512.2...
Executing lofreq filter -i /tmp/lofreq2-call-dyn-bonf.02eISt -o /tmp/tmp4o_5qgnm/tmp/lofreq2_call_parallelrl_qk5ep/2.vcf.gz --no-defaults --snvqual-thresh 67 --indelqual-thresh 62
Number of substitution tests performed: 2916
Number of indel tests performed: 821
Successful exit.

Standard Output:

INFO [2024-10-21 05:22:57,023]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam

INFO [2024-10-21 05:22:57,034]: Adding 3 commands to mp-pool
Traceback (most recent call last):
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 751, in <module>
    main()
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 678, in main
    concat_vcf_files(vcf_files, vcf_concat,
  File "/usr/local/bin/lofreq2_call_pparallel.py", line 175, in concat_vcf_files
    subprocess.check_call(cmd)
  File "/usr/local/lib/python3.12/subprocess.py", line 408, in check_call
    retcode = call(*popenargs, **kwargs)
              ^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/usr/local/lib/python3.12/subprocess.py", line 389, in call
    with Popen(*popenargs, **kwargs) as p:
         ^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/usr/local/lib/python3.12/subprocess.py", line 1026, in __init__
    self._execute_child(args, executable, preexec_fn, close_fds,
  File "/usr/local/lib/python3.12/subprocess.py", line 1955, in _execute_child
    raise child_exception_type(errno_num, err_msg, err_filename)
FileNotFoundError: [Errno 2] No such file or directory: 'bcftools'

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 19: toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp4o_5qgnm/files/e/e/6/dataset_ee6e91cc-e5c9-45bd-ac35-d2ae68737e6c.dat' 'SRR11578257' &&  qualimap bamqc -bam 'SRR11578257' -outdir results -outformat html --collect-overlap-pairs -nw 400 --paint-chromosome-limits -hm 3  --skip-duplicated --skip-dup-mode 0 -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp4o_5qgnm/job_working_directory/000/16/outputs/dataset_c8b38a5c-c787-4116-9f5c-70e293ccc720.dat' && mkdir '/tmp/tmp4o_5qgnm/job_working_directory/000/16/outputs/dataset_c8b38a5c-c787-4116-9f5c-70e293ccc720_files' && mv results/css/*.css '/tmp/tmp4o_5qgnm/job_working_directory/000/16/outputs/dataset_c8b38a5c-c787-4116-9f5c-70e293ccc720_files' && mv results/css/*.png '/tmp/tmp4o_5qgnm/job_working_directory/000/16/outputs/dataset_c8b38a5c-c787-4116-9f5c-70e293ccc720_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp4o_5qgnm/job_working_directory/000/16/outputs/dataset_c8b38a5c-c787-4116-9f5c-70e293ccc720_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.3
Built on 2023-05-19 16:57

Selected tool: bamqc
Available memory (Mb): 253
Max memory (Mb): 1037
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Only flagged duplicate alignments will be skipped...
Number of windows: 400, effective number of windows: 399
Chunk of reads size: 1000
Number of threads: 1
Processed 50 out of 399 windows...
Processed 100 out of 399 windows...
Processed 150 out of 399 windows...
Processed 200 out of 399 windows...
Processed 250 out of 399 windows...
Processed 300 out of 399 windows...
Processed 350 out of 399 windows...
Total processed windows:399
Number of reads: 388772
Number of valid reads: 388778
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 388772
Num mapped first of pair: 194387
Num mapped second of pair: 194385
Num singletons: 0
Time taken to analyze reads: 8
Computing descriptors...
numberOfMappedBases: 55519498
referenceSize: 29903
numberOfSequencedBases: 55509362
numberOfAs: 16953562
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 8
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`["0"]`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "400", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( ( DP4[2] + DP4[3] ) >= ( 0.1 * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( 1 * DP ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 3: ARTIC primer BED:
- step_state: scheduled

Step 21: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 22: __FILTER_FAILED_DATASETS__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "3f613bfa8f6c11ef80abb18eb6686484"
      
      input {"values": [{"id": 16, "src": "dce"}]}

Step 23: toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.4.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
amplicons	`{"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "computed": "no"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`

Step 24: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "3f613bfa8f6c11ef80abb18eb6686484"
      
      input {"values": [{"id": 26, "src": "hdca"}]}
      
      join_identifier "_"

Step 25: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
call_control	{"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}}
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_control	`{"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"}`
reference_source	`{"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}`
regions	`{"__current_case__": 0, "restrict_to_region": "genome"}`
variant_types	`"--call-indels"`

Step 26: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&     ln -s '/tmp/tmp4o_5qgnm/files/a/e/2/dataset_ae21df72-ae8e-4814-b0be-d6205f3b43fc.dat' 'multiqc_WDir/fastp_0/SRR11578257fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/SRR11578257fastp.json' || die "'report_title' or 'report_title' not found in the file" &&  mkdir multiqc_WDir/samtools_1 &&    mkdir 'multiqc_WDir/samtools_1/stats_0' &&      grep -q 'This file was produced by samtools stats' /tmp/tmp4o_5qgnm/files/b/6/3/dataset_b63259bc-59d7-4118-85bd-7e6be90a9caf.dat || die "Module 'samtools: 'This file was produced by samtools stats' not found in the file 'SRR11578257'" && ln -s '/tmp/tmp4o_5qgnm/files/b/6/3/dataset_b63259bc-59d7-4118-85bd-7e6be90a9caf.dat' 'multiqc_WDir/samtools_1/stats_0/SRR11578257'  &&    mkdir multiqc_WDir/qualimap_2 &&  sample="$(grep 'bam file = ' /tmp/tmp4o_5qgnm/files/2/1/7/dataset_217678b4-da8c-4f23-b0a8-62142764c834.dat | sed 's/bam file = //g' | sed 's: ::g')" && dir_name="multiqc_WDir/qualimap_2/${sample}" && mkdir -p ${dir_name} && filepath_1="${dir_name}/genome_results.txt" && ln -sf '/tmp/tmp4o_5qgnm/files/2/1/7/dataset_217678b4-da8c-4f23-b0a8-62142764c834.dat' ${filepath_1} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_2="${nested_dir_name}/coverage_histogram.txt" && ln -sf '/tmp/tmp4o_5qgnm/files/1/9/e/dataset_19e9479d-85ec-4371-b365-ad2917278bf2.dat' ${filepath_2} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_3="${nested_dir_name}/mapped_reads_gc-content_distribution.txt" && ln -sf '/tmp/tmp4o_5qgnm/files/4/c/c/dataset_4cc51383-638b-452d-9eac-3939995a4287.dat' ${filepath_3} &&   multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmp4o_5qgnm/job_working_directory/000/30/working/multiqc_WDir

          qualimap | Found 1 BamQC reports
          samtools | Found 1 stats reports
             fastp | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
     write_results | Plots       : report_plots
           multiqc | MultiQC complete

Standard Output:

total 1428
-rw-r--r-- 1 1001 127    7517 Oct 21 05:24 fastp-insert-size-plot.txt
-rw-r--r-- 1 1001 127    2973 Oct 21 05:24 fastp-seq-content-gc-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 127    2991 Oct 21 05:24 fastp-seq-content-gc-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 127    2973 Oct 21 05:24 fastp-seq-content-gc-plot_Read_2_After_filtering.txt
-rw-r--r-- 1 1001 127    3035 Oct 21 05:24 fastp-seq-content-gc-plot_Read_2_Before_filtering.txt
-rw-r--r-- 1 1001 127    2317 Oct 21 05:24 fastp-seq-content-n-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 127    2511 Oct 21 05:24 fastp-seq-content-n-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 127    2259 Oct 21 05:24 fastp-seq-content-n-plot_Read_2_After_filtering.txt
-rw-r--r-- 1 1001 127    2452 Oct 21 05:24 fastp-seq-content-n-plot_Read_2_Before_filtering.txt
-rw-r--r-- 1 1001 127    2644 Oct 21 05:24 fastp-seq-quality-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 127    2651 Oct 21 05:24 fastp-seq-quality-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 127    2657 Oct 21 05:24 fastp-seq-quality-plot_Read_2_After_filtering.txt
-rw-r--r-- 1 1001 127    2655 Oct 21 05:24 fastp-seq-quality-plot_Read_2_Before_filtering.txt
-rw-r--r-- 1 1001 127      73 Oct 21 05:24 fastp_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127     307 Oct 21 05:24 multiqc_citations.txt
-rw-r--r-- 1 1001 127 1204365 Oct 21 05:24 multiqc_data.json
-rw-r--r-- 1 1001 127  129002 Oct 21 05:24 multiqc_fastp.txt
-rw-r--r-- 1 1001 127    1892 Oct 21 05:24 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127     324 Oct 21 05:24 multiqc_qualimap_bamqc_genome_results.txt
-rw-r--r-- 1 1001 127    1318 Oct 21 05:24 multiqc_samtools_stats.txt
-rw-r--r-- 1 1001 127      51 Oct 21 05:24 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127     808 Oct 21 05:24 multiqc_sources.txt
-rw-r--r-- 1 1001 127    8056 Oct 21 05:24 qualimap_coverage_histogram.txt
-rw-r--r-- 1 1001 127    1939 Oct 21 05:24 qualimap_gc_content.txt
-rw-r--r-- 1 1001 127   12377 Oct 21 05:24 qualimap_genome_fraction.txt
-rw-r--r-- 1 1001 127     309 Oct 21 05:24 samtools-stats-dp.txt
-rw-r--r-- 1 1001 127      45 Oct 21 05:24 samtools_alignment_plot.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`true`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 8, "src": "hdca"}]}, "type": "stats"}}], "software": "samtools"}}, {"__index__": 2, "software_cond": {"__current_case__": 20, "input": {"values": [{"id": 27, "src": "hdca"}]}, "software": "qualimap"}}]`
saveLog	`"false"`
title	`""`

Step 27: toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
output_type	`"v"`
sec_annofile	`{"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 34, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "-AmpliconBias", "min_overlap": "", "set_id": ""}`
sec_annotate	`{"remove": "", "rename_annots": null, "rename_chrs": null}`
sec_restrict	`{"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null}`

Step 28: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_expression	`{"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"}`
filtering	`{"__current_case__": 0, "mode": "entries"}`
inverse	`false`

Step 29: toolshed.g2.bx.psu.edu/repos/devteam/vcfvcfintersect/vcfvcfintersect/1.0.0_rc3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
adv_options	`{"__current_case__": 0, "adv_options_selector": "no"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`true`
isect_union	`"-i"`
loci	`false`
reference_source	`{"__current_case__": 1, "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"}`
window_size	`"0"`

Step 30: toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
output_type	`"v"`
sec_annofile	`{"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 37, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "+AmpliconBias", "min_overlap": "", "set_id": ""}`
sec_annotate	`{"remove": "", "rename_annots": null, "rename_chrs": null}`
sec_restrict	`{"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null}`

Step 4: ARTIC primers to amplicon assignments:
- step_state: scheduled

Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "^##INFO=<ID=AmpliconBias,.+$", "replace_pattern": "##INFO=<ID=AmpliconBias,Number=0,Type=Flag,Description=\"Indicates that the AF value of the variant could not be corrected for potential amplicon bias.\">"}, {"__index__": 1, "find_pattern": "^##INFO=<ID=AF,.+$", "replace_pattern": "##INFO=<ID=AF,Number=1,Type=Float,Description=\"Lofreq Allele Frequency; Fraction of variant-supporting bases with q > --min-bq among all bases at the site\">"}]`

Step 32: SnpEff eff covid19 version:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
annotations	`["-formatEff", "-classic"]`
chr	`""`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`["-no-downstream", "-no-intergenic", "-no-upstream"]`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 33: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is new

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
af	`{"af_max": "0.0", "af_min": "0.0"}`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
coverage	`{"cov_max": "0", "cov_min": "0"}`
dbkey	`"?"`
filter_by_type	`{"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}}`
flag_or_drop	`"--print-all"`
sb	`{"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}}`

Step 5: Read removal minimum AF:
- step_state: scheduled
Step 6: Read removal maximum AF:
- step_state: scheduled
Step 7: Minimum DP required after amplicon bias correction:
- step_state: scheduled
Step 8: Minimum DP_ALT required after amplicon bias correction:
- step_state: scheduled

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmp4o_5qgnm/files/8/d/7/dataset_8d732e5a-0f5b-4608-8cce-a67d7637cc00.dat' 'SRR11578257.fastqsanger.gz' && ln -sf '/tmp/tmp4o_5qgnm/files/b/5/3/dataset_b537926b-37d0-4852-9c91-072381360c09.dat' 'SRR11578257_R2.fastqsanger.gz' &&  cp '/tmp/tmp4o_5qgnm/job_working_directory/000/6/configs/tmp5bmwtvoe' galaxy.json &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11578257.fastqsanger.gz'   -i 'SRR11578257.fastqsanger.gz'   -I 'SRR11578257_R2.fastqsanger.gz' -o first.fastqsanger.gz -O second.fastqsanger.gz                                                && mv first.fastqsanger.gz '/tmp/tmp4o_5qgnm/job_working_directory/000/6/outputs/dataset_71440cac-ac46-473f-b4c6-183ec3841d8d.dat' && mv second.fastqsanger.gz '/tmp/tmp4o_5qgnm/job_working_directory/000/6/outputs/dataset_37548cdf-335f-476e-84a7-a31a6c68a70b.dat'

Exit Code:

```
0
```

Standard Error:

Read1 before filtering:
total reads: 201367
total bases: 29302687
Q20 bases: 28139796(96.0315%)
Q30 bases: 27281893(93.1037%)

Read2 before filtering:
total reads: 201367
total bases: 29398146
Q20 bases: 27778430(94.4904%)
Q30 bases: 26748339(90.9865%)

Read1 after filtering:
total reads: 197961
total bases: 28794778
Q20 bases: 27771017(96.4446%)
Q30 bases: 26956923(93.6174%)

Read2 after filtering:
total reads: 197961
total bases: 28807154
Q20 bases: 27394032(95.0945%)
Q30 bases: 26419337(91.711%)

Filtering result:
reads passed filter: 395922
reads failed due to low quality: 5636
reads failed due to too many N: 1176
reads failed due to too short: 0
reads with adapter trimmed: 16490
bases trimmed due to adapters: 89039

Duplication rate: 20.2521%

Insert size peak (evaluated by paired-end reads): 230

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR11578257.fastqsanger.gz -i SRR11578257.fastqsanger.gz -I SRR11578257_R2.fastqsanger.gz -o first.fastqsanger.gz -O second.fastqsanger.gz 
fastp v0.23.4, time used: 5 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 2, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "detect_adapter_for_pe": false, "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "merge_reads": {"__current_case__": 1, "merge": ""}, "paired_input": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"3f613bfa8f6c11ef80abb18eb6686484"`
chromInfo	`"/tmp/tmp4o_5qgnm/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( ( DP4[2] + DP4[3] ) >= ( ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 2, "component_value": "0.1", "select_param_type": "float"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 2, "component_value": "1.0", "select_param_type": "float"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " * DP ) )", "select_param_type": "text"}}]
dbkey	`"?"`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - b8aa99e0632825f3
- history_state
  - error
- invocation_id
  - b8aa99e0632825f3
- invocation_state
  - scheduled
- workflow_id
  - b8aa99e0632825f3

gxydevbot · 2024-11-18T05:25:15Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2025-01-27T05:26:35Z

There are new updates, they have been integrated to the PR, check the file diff.

…artic-variant-calling from 0.5.3 to 0.5.4

gxydevbot · 2025-02-10T05:35:17Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot changed the title ~~Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3~~ Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 May 27, 2024

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from ce4c0f6 to aa1ffff Compare September 23, 2024 14:45

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from aa1ffff to 0ed02a0 Compare September 24, 2024 14:22

wm75 mentioned this pull request Oct 1, 2024

Tool updates (no expected functional changes) to PE ARTIC WF #545

Merged

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from 0ed02a0 to 934a9c2 Compare October 7, 2024 05:19

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from 934a9c2 to e49875e Compare October 21, 2024 05:10

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from e49875e to fbd2280 Compare November 18, 2024 05:25

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from fbd2280 to 5dd588e Compare January 27, 2025 05:26

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-…

4aef9d8

…artic-variant-calling from 0.5.3 to 0.5.4

gxydevbot force-pushed the workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling branch from 5dd588e to 4aef9d8 Compare February 10, 2025 05:35

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 #389

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 #389

gxydevbot commented Apr 8, 2024

github-actions bot commented Jun 24, 2024

Workflow invocation details

gxydevbot commented Sep 23, 2024

gxydevbot commented Sep 24, 2024

gxydevbot commented Oct 7, 2024

gxydevbot commented Oct 21, 2024

github-actions bot commented Oct 21, 2024

Workflow invocation details

gxydevbot commented Nov 18, 2024

gxydevbot commented Jan 27, 2025

gxydevbot commented Feb 10, 2025

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 #389

Are you sure you want to change the base?

Updating workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling from 0.5.2 to 0.5.3 #389

Conversation

gxydevbot commented Apr 8, 2024

github-actions bot commented Jun 24, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Sep 23, 2024

gxydevbot commented Sep 24, 2024

gxydevbot commented Oct 7, 2024

gxydevbot commented Oct 21, 2024

github-actions bot commented Oct 21, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Nov 18, 2024

gxydevbot commented Jan 27, 2025

gxydevbot commented Feb 10, 2025